Information

Is there natural occurrence of induced pluripotency / expression of Yamanaka factors and what is the evolutionary explanation of that?


Is there natural biological processes in which the full (full reprogramming into pluripotent state) or partial (partial reprogramming, stopped before point-of-no-return, preserving the functional distinctiveness of the cell) induced pluripotency (https://en.wikipedia.org/wiki/Induced_pluripotent_stem_cell) and expression of Yamanaka factors occurrs? What is the evolutionary explanation of such rejuvenation factors? I would like to see the natural explanation otherwise it begs for the idea that the Universe is created with the human as the goal of it (anthropocentric hypothesis) and it is quite uneasy for me.

I guess, that natural reproduction processes can involve some kind of rejuvenation/induced pluripotency and they determined the existence of Yamanaka factors.


What is a pluripotent stem cell?

A pluripotent stem cell is a cell that can differentiate into any of the major tissue categories. Every animal exists as a collection of pluripotent stem cells at an early stage of development: if you are looking for an evolutionary purpose, that's where you should start, and the purpose is pretty obvious: you start as a single fertilized egg and end up as a complex collection of tissues, so at some point that one cell has to become a collection of tissues, and there is an intermediate step which is a pluripotent cell.

None of this has anything to do with induced pluripotency, however.

What makes a cell pluripotent?

The answer to this question isn't really all that unique to stem cells: all cell types are differentiated from others based on their expression of transcription factors. Transcription factors determine what proteins get produced (including other transcription factors), which in turn determines how a cell functions and what role it plays.

Pluripotent stem cells express pluripotent stem cell transcription factors. Yamanaka started with embryonic stem cells, and looked for transcription factors that were special to those cells.

What does it mean to make a pluripotent stem cell?

Given that the identity of a cell is based on the transcription factors it expresses, the way to make one cell type act like another cell type is to change those transcription factors. A cell is a pretty complicated environment: there are lots of different transcription factors and lots of other types of proteins, so it's possible that it wouldn't be feasible to reprogram a cell this way.

However, Yamanaka and colleagues tried to artificially make an adult cell produce those transcription factors observed in embryonic stem cells. Indeed, they found that if they used the right combination of transcription factors in the right environment, the cells started to behave like embryonic cells, and they could further make those cells differentiate into different tissue types. These transcription factors are the so-called Yamanaka factors.

Summary

An induced pluripotent stem cell is a cell that has been transformed to produce transcription factors that are found in embryonic cells. Transcription factors are what make different cell types different from each other, by controlling everything else that the cell produces. All of this machinery is ubiquitous in development, the only intervention that the humans are doing is to make a cell express genes it would normally only express if it was an embryonic cell.

All of this information is already present in the Wikipedia article you linked.


Takahashi K, Yamanaka S (2006). "Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors". Cell. 126 (4): 663-76.

Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S (2007). "Induction of pluripotent stem cells from adult human fibroblasts by defined factors". Cell. 131 (5): 861-72.

Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Slukvin II, Thomson JA (2007). "Induced pluripotent stem cell lines derived from human somatic cells". Science. 318 (5858): 1917-20.


Regeneration of complex tissues like limbs is known in many animals. Salamander has been used as a model for limb regeneration. During regeneration, the cells at the amputation site de-differentiate to form what is known as a blastema which in turn differentiates to form different kinds of cells.

Christen et al. (2010) have found that de-differentiation in zebrafish involves upregulation of some of the Yamanaka factors.

We found that some of the pluripotency associated factors (oct4/pou5f1, sox2, c-myc, klf4, tert, sall4, zic3, dppa2/4 and fut1, a homologue of ssea1) were expressed before and during regeneration and that at least two of these factors (oct4, sox2) were also required for normal fin regeneration in the zebrafish. However these factors were not upregulated during regeneration as would be expected if blastema cells acquired pluripotency

There is evidence for the expression of the homologs of Sox-2, Klf4 and c-Myc in regenerating newt tissues as well (Maki et al., 2009)

Having said that, I would reiterate what Bryan Krause said in his answer: these factors are essential for the renewal and maintenance of embryonic stem cells. Some of these factors (especially Sox2) are also expressed in non-embryonic multipotent cells like neural stem cells (Seo et al., 2011; Sarkar and Hochedlinger, 2013; Zhang and Cui, 2014).

c-Myc is a proto-oncogene and is normally involved in cell proliferation in all actively dividing cells.


Expression analysis of pluripotency factors in the undifferentiated porcine inner cell mass and epiblast during in vitro culture

Limited understanding of the importance of known pluripotency factors in pig embryonic stem cells (ESC) impedes the establishment and validation of porcine ESC lines. This study evaluated the expression of known mouse ESC and human ESC (hESC) pluripotency markers in in vivo inner cell mass (ICM) and in vitro‐cultured undifferentiated porcine epiblast cells isolated from 8‐day porcine blastocysts, primary cultures of epiblast‐derived neuroprogenitor cells, and endoderm cells. The expression profile of common pluripotency markers (POU domain 5 transcript factor 1, SRY‐box containing gene 2, and Nanog homeobox), species‐specific markers, ESC‐associated factors, and differentiation markers was evaluated. The mRNA of uncultured ICMs, cultured epiblast cells, epiblast‐derived neuroprogenitor cells, and endoderm cells was amplified prior to expression analysis of candidate genes by real‐time RT‐PCR. ESC factors whose expression correlated best with the undifferentiated epiblast state were identified by comparative mRNA expression analysis between porcine epiblast‐derived somatic cell lines, fetal fibroblasts, and adult tissues. Across tissue types Nanog homeobox exhibited ubiquitous expression, whereas POU domain 5 transcript factor 1, teratocarcinoma‐derived growth factor 1, and RNA exonuclease homolog 1 transcript expression was restricted primarily to undifferentiated epiblasts. Our results suggested that expression of pluripotency markers in undifferentiated pig epiblast cells more closely resembled that observed in hESC. Expression alterations of ESC‐associated factors in epiblast cells were also observed during in vitro culture. Our data demonstrate the potential use of some pluripotency factors as markers of porcine epiblast stem cells and indicate that the in vitro environment may influence the cultured epiblast's developmental state. Mol. Reprod. Dev. 75: 450&ndash463, 2008. © 2007 Wiley‐Liss, Inc.

Journal

Molecular Reproduction & Development &ndash Wiley

Published: Mar 1, 2008

Keywords: epiblast inner cell mass pluripotency embryonic stem cell trophectoderm


Introduction

Cancer exomes and genomes are sequenced through concerted international efforts by multicenter consortia leading to the curation of vast datasets of cancer-associated mutations. However, which of these mutations actually drive cancer and how they affect the function of the mutated protein is largely unclear. In particular, distinguishing cancer driver from passenger mutations remains a major challenge. Driver mutations confer growth advantages with causal roles in disease progression, while passengers are coincidental and without impact on the fitness of cancer cells [1] . Therefore, investigating the functional consequences of variants of uncertain significance is a major goal for medical genetics. To systematically interrogate the impact of missense mutations in cancer driver genes, high-throughput assays have been implemented for the tumor suppressors like p53 [2] , PTEN [3] , and BRCA1 [4] by assessing cell survival, protein abundance, enzymatic activity, or cofactor binding.

The generation of induced pluripotent stem cells (iPSCs) with cocktail of SRY-related box 2 (SOX2), octamer-binding protein 4 (OCT4), Krüppel-like factor 4 (KLF4), and cellular MYC (c-Myc) demonstrated that the forcible expression of transcription factors (TFs) leads to the dramatic reprogramming of cellular states [5, 6] . It has subsequently been noted that somatic cell reprogramming to a pluripotent state and oncogenic transformations have many conceptual parallels [7] . Pluripotency reprogramming and tumorigenesis critically rely on the formation of self-renewing cell populations. Both processes entail profound epigenetic changes, metabolic switching, transitions between mesenchymal and epithelial characteristics, as well as proliferative and morphological changes. In addition, all four classical pluripotency reprogramming factors, SOX2 [8-10] , OCT4 [11] , KLF4 [12] , and c-MYC [13] , have been reported to be associated with or even drive oncogenesis. These considerations motivated us to ask whether the reprogramming of somatic cells to pluripotency provides a suitable experimental system to study the functional impact of cancer-associated missense mutations. SOX17 normally does not support pluripotency induction when substituted for SOX2 [14] . We nevertheless included SOX17 in our study for its demonstrated conversion into a pluripotency inducer with single missense mutation [15, 16] and its classification as mutated cancer driver gene in endometrial cancer [17-19] .

To explore whether cancer-associated missense mutations affect pluripotency reprogramming, we selected mutations mapping to OCT4, SOX2, and SOX17 and tested them in the conversion of mouse embryonic fibroblasts (MEFs) to iPSCs. OCT4 is a key regulator of pluripotency, totipotency, and germline specification [20] . The OCT4 protein belongs to the Pit-OCT-Unc (POU) family with a bipartite DNA-binding domain mediating the recognition of an octameric ATGCAAAT-like DNA sequence element [21] and of several variants of palindromic sequences where it binds as homodimer (reviewed in [22] ). SOX2 and SOX17 belong to the family of high-mobility group (HMG) box factors related to the testis-determining factor SRY (hence their name SRY-related box: SOX) that recognize CATTGTC-like DNA sequences [23] . The POU and HMG box domains not only mediate sequence specific DNA binding, but also the formation of DNA-dependent heterodimers (reviewed in [24] ). For example, during pluripotency reprogramming and the maintenance of a pluripotent state, SOX2 and OCT4 heterodimerize [25-29] . Their association is facilitated by a dedicated protein contact interface at helix 3 of the HMG box, the POU-specific (POUS) domain of OCT4 along with a composite ‘canonical’ CATTGTCATGCAAT-like DNA element [30] . During the specification of the extraembryonic primitive endoderm, OCT4 switches partners and now associates with SOX17 on an alternative ‘compressed’ CATTGTATGCAAAT-like DNA element [15, 31] . Recently, SOX17/OCT4 heterodimers have also been proposed to specify the human germline [32, 33] . Domain swapping and mutational analyses have revealed that the capacity of SOX2 and OCT4 to induce pluripotency mainly relies on features of their DNA-binding HMG and POU domains while regions outside these domains are less critical for their specific functions [34-37] . Mutations within HMG and POU domains were found to disrupt the ability of SOX2 and OCT4 to generate iPSCs [15, 35, 36, 38-40] . In pluripotency reprogramming experiments, the neural factor OCT6 and the endodermal factor SOX17 cannot substitute for OCT4 and SOX2, respectively [14] . However, both proteins could be rationally mutated to replace OCT4 and SOX2 in pluripotency reprogramming with mutations in the POU and HMG domains, respectively [15, 34, 35] . In SOX17, a single amino acid substitution converts this protein into a highly efficient pluripotency inducer that outperforms SOX2 in both mouse and human reprogramming [15, 34] .

Here, we mined the comprehensive Catalogue of Somatic Mutations in Cancer (COSMIC) database (http://cancer.sanger.ac.uk) [41] for missense mutations mapping to SOX and POU family members and selected variants with a potential to affect the capacity of OCT4, SOX2, and SOX17 to generate iPSCs. We identified two cancer-associated mutations that enhance the reprogramming activity of OCT4 (OCT-K128N, OCT4-C198R) and several SOX2 mutations that attenuate or moderately elevate its reprogramming activity. We show that the SOX17-V118M mutation observed in four different tumor samples (prostate, breast and intestinal carcinoma) converts SOX17 into a pluripotency inducer, leads to increased protein stability and promotes tumorigenic transformation. We propose cellular reprogramming as a suitable assay to study the sequence–structure–function relationship of cancer mutations. We predict that hotspot mutation sites present a valuable guide for the design of libraries for the scalable directed evolution of reprogramming factors by cell selection and sequencing [16, 42] .


MATERIALS AND METHODS

Mouse husbandry, staging, culture and micromanipulation of embryos

Mice were maintained on a 12-hour light/12-hour dark cycle. For timed matings, noon on the day of the vaginal plug was designated E0.5. Except where stated, wild-type strains were MF1 or 129/Ola. Gastrulation-stage embryos were staged as described (Downs and Davies, 1993): ES, early streak MS, mid-streak LS, late streak OB, no allantoic bud EB, early allantoic bud LB, late allantoic bud EHF, early headfold LHF, late headfold.

Embryos were cultured in static 4-well dishes in an incubator at 5% CO2 in air in 50% rat serum as described (Copp, 1990). Blastocyst injection and embryo transfer was performed using standard procedures.

Ubiquitously induced Oct4 expression was achieved by crossing wild-type females with homozygous males carrying both the doxycycline-inducible reverse tet transactivator (rtTA) targeted at Rosa26 and a doxycycline-responsive Oct4 transgene (TgOct4) targeted at Col1a1 [B6129-Gt(ROSA)26Sor tm1(rtTA*M2)Jae Col1a1 tm2(tetO-Pou5f1)Jae/J (Hochedlinger et al., 2005)].

Dissection of tissues for grafting, explant culture and expression analysis

Wild-type (C57BL/6, 129 and CBA) embryo subregions were dissected in M2 (Sigma) as described (Cambray and Wilson, 2007). To dissect distal/anterior (Nanog:GFP negative) and proximal/posterior (Nanog:GFP positive) regions of the E7.5 embryo, embryos were first ordered relative to developmental stage and imaged to assess GFP-positive and -negative regions. A transverse cut was made to separate the most proximal epiblast, containing primordial germ cells, together with the extra-embryonic region, from the distal epiblast. A second cut was made to separate the distal/anterior from posterior/proximal regions. Finally, the embryos were viewed with fluorescence optics to check the accuracy of microdissection any remaining Nanog-GFP-positive cells were trimmed from distal-anterior regions. To dissect prospective forebrain (region 1) and adjacent region (region 2), extra-embryonic membranes were removed and the embryo laid flat dorsoventrally, with the aid of a transverse cut near the node if necessary (see Fig. 5). Forebrain and adjacent region were then separated with glass needles.

Teratocarcinoma assays

Kidney capsule grafts were performed as described (Tam, 1990), except that transfer to NOD/SCID mice was performed in a laminar flow cabinet. After transplanting E8.5 TgOct4/+rtTA/+ forebrains, half of the host animals were administered 1 mg/ml doxycycline (Sigma) through the drinking water for 4 weeks. Tumours were recovered at 4-6 weeks and fixed in 4% paraformaldehyde (PFA) for 1-7 days depending on tumour size. Tissue was processed and stained as described (Bancroft and Gamble). Tissues representative of different germ layers used for scoring all tumours are shown in supplementary material Fig. S2.

Explantation and culture of EpiSC

To derive E7.5-E8.0 (OB-2s) EpiSC lines, embryos were dissected, dissociated (without removal of endoderm or mesoderm) and explanted into EpiSC medium (Tesar et al., 2007) supplemented with 20 ng/ml activin-A (PeproTech) and 10 ng/ml bFGF (R & D) and plated on irradiated mouse embryo fibroblasts (MEFs). After 2-3 days, primary explants were passaged by incubation with 1× accutase (Sigma, Catalogue number A 6964) (5 minutes) and then triturated into 10- to 100-cell clumps, neutralized with EpiSC medium and replated. Subsequent passages were performed every 5-6 days. Cultures were designated as cell lines when they had reached passage 3, exhibiting EpiSC morphology and robust proliferation.

TgOct4-overexpressing explants and EpiSCs were derived from TgOct4/TgOct4rtTA/rtTA homozygous male crossed with either 129/Ola wild-type or Nanog:GFP [129-Nanog tm1(GFP-IRES-Puro) ] females, derived from TNG targeted ES cells (Chambers et al., 2007). Medium was initially supplemented with 1 mg/ml doxycycline, and reduced to 0.5 mg/ml after three passages. Nanog –/– EpiSCs were derived in vitro from ES cells as described (Guo et al., 2009) and passaged in accutase as above. Oct4GiP EpiSCs were derived from ES cells carrying an Oct4-promoter driven eGFPiresPuroR-polyA transgene (Ying et al., 2002). When added, chemical inhibitors were used at these concentrations: PD0325901 (Stemgent), 1 μM SB 431542 (Sigma), 10 μM JAK inhibitor I (Calbiochem 420099), 0.6 mM.

Teratocarcinoma-derived secondary EpiSCs

Tumours were isolated and chopped roughly before dissociation in 0.5% trypsin/2.5% pancreatin in PBS (37°C, 15 minutes). After trituration, cells were plated onto irradiated MEFs in EpiSC media, passaged the next day and then every 2-3 days.

RNA analysis

Total RNA (30 ng-1 μg) isolated using the RNeasy microkit or minikit (Qiagen), was used for cDNA synthesis using SuperScript III (Invitrogen). Quantitative PCR was performed using Light Cycler 480 SYBR Green I Master Mix (Roche). PCR primer sequences are available on request. Values for each gene were normalized to expression of TATA-box binding protein (TBP) and expressed as mean±s.e.m. of at least three replicates, relative to ES cell levels.

Immunohistochemistry and immunocytochemistry

Whole embryos or cultured cells were fixed using 4% PFA in PBS for 2 hours (embryos) or 10 minutes (cells) at 4°C followed by permeabilization in 0.5% Triton X100 (Sigma) in PBS for 15 minutes. Samples were incubated in 1 M glycine in PBS/0.1% TritonX100 (PBST) for 20 minutes and blocked overnight at 4°C using 3% serum (Sigma), 1% BSA (Sigma) in PBST. Primary antibodies were diluted in blocking buffer to the working concentrations indicated below and applied for 1-2 hours at room temperature (cells) or 48 hours at 4°C (embryos). After three (cells) or four to six (embryos) PBST washes (15 minutes at room temperature), Alexa-conjugated secondary antibodies (Molecular Probes 2 μg/ml in blocking buffer) were applied for 1 hour (cells) or 3 hours (embryos) in the dark at room temperature. Cells/embryos were then washed at least three times in PBST followed by incubation in 4′,6-diamidino-2-phenylindole (DAPI) to stain nuclei. Primary antibody concentrations were: Nanog, 1.4 μg/ml (Chambers, 2004) (embryos) or 2.5 μg/ml (ab14959, Abcam) (cells) Oct4, 1 μg/ml (Santa Cruz, N-19) (embryos) or 1 μg/ml (Santa Cruz, C-10) (cells) Sox2, 1 μg/ml (Santa Cruz, Y-17) (cells).

In situ hybridization

Whole-mount in situ was performed as described (Wilkinson et al., 1990) proteinase K treatment was empirically adjusted between 8-16 minutes according to embryo size and stage. The riboprobes used were: Oct4 (Scholer et al., 1990) and Nanog (Chambers et al., 2003). Embryos were sectioned in paraffin wax (7 μm).

Imaging

Images were captured using Volocity (Improvision) software on a Zeiss Stemi SV11 dissecting microscope (for whole embryos), an Olympus IX51 (for cultured cells), or an Olympus BX61 (for sections). Image processing was performed using Adobe Photoshop software. In the case of whole embryos stained with Oct4, fluorescence was visualized using a Leica DM IRE2 inverted confocal microscope (Leica Microsystems). Image acquisition and processing were carried out using the Leica Confocal (Leica Microsystems) and Volocity (Improvision) software packages, respectively.

Image analysis

To quantify fluorescence signal per nucleus, we generated a semi-automated image analysis pipeline. Regions of interest in embryos were cropped and analysed in parallel with an internal negative control region (supplementary material Fig. S5). These RGB images were pre-processed [background subtraction in each channel and gamma correction in the blue channel (DAPI) to enhance weakly fluorescing nuclei] using our own plug-in in ImageJ (http://rsbweb.nih.gov/ij/). To distinguish individual nuclei, the blue channel was segmented using a previously published algorithm (Li et al., 2007) with the following parameters and their respective values for 2D and 3D images: sigma 0.1 (2D)0.15 (3D), minimum nucleus size 350 pixels (2D and 3D), and fusion threshold 2 (2D)1 (3D) see supplementary material Fig. S5). In the resulting image, each nucleus is labelled with a unique greyscale-based identifier. Using a Java application that we developed within eclipse (www.eclipse.org), average pixel intensities in the red and green channels of the preprocessed RGB image were calculated within the superimposed volume of each nucleus. Charts representing red and green average intensities were generated using the Jfreechart library (http://www.jfree.org/jfreechart/). Applications developed for this analysis can be downloaded at http://www.crm.ed.ac.uk/research/group/embryonic-stem-cell-differentiation.

DNA methylation analysis

Bisulphite sequencing was performed using the Imprint DNA modification kit (Sigma) together with primers meNanog-F2-S and meNanog-F2-AS (Imamura et al., 2006). Approximately 30 clones were sequenced sequences characterized by incomplete bisulphite conversion were discarded.

Formaldehyde-assisted isolation of regulatory elements (FAIRE)

MEFs or E14Tg2a cells (1×10 7 ) were used. MF1 embryos, staged as described previously (Downs and Davies, 1993) were dissected free of extra-embryonic tissue (including the allantois containing primordial germ cells). Embryos were pooled [for E7.5 (LB-EHF), 27-30 embryos for E8.5 (2-8 somites), 20-22 embryos] and dissociated in 0.5% trypsin/2.5% pancreatin/PBS. For E8.5 explants, 20-22 dissociated embryos were cultured in EpiSC conditions with or without 1 mg/ml doxycycline. After 24 hours, explants were trypsinized, replated on non-gelatinized tissue culture dishes for 15 minutes to deplete feeders and collected.

Formaldehyde-crosslinked, sonicated chromatin was prepared as previously described (Navarro et al., 2010) and 20 μg used to prepare FAIRE and reference samples. For the FAIRE sample, protein-free DNA molecules of the crosslinked chromatin were purified by phenol-chloroform extraction and ethanol precipitated as described previously (Giresi et al., 2007). For the reference sample, crosslinking was reversed by overnight incubation at 65°C in TE/1% SDS, phenol-chloroform extracted and ethanol precipitated. FAIRE and reference samples were analysed in parallel using a LightCycler 480 (Roche) and LightCycler 480 SYBR Green 1 Master (Roche). Primer sequences were: Nanog, TGGCCTTCAGATAGGCTGAT (sense) and CAAGAAGTCAGAAGGAAGTGAGC (antisense) Sox2, AGGGCTGGGAGAAAGAAGAG (sense) and CCGCGATTGTTGTGATTAGTT (antisense) Oct4 distal enhancer AGAGTGCTGTCTAGGCCTTA (sense) and CCAGAACTCTCAACCTCCCT (antisense) Oct4 proximal enhancer, GGGAAGCAGGGTATCTCCAT (sense) and TCCCCTCACACAAGACTTCC (antisense).


NEW STUDY DISPROVES ALL MAINSTREAM THEORIES OF AGING-AND REVEALS THE NEW: PROGRAMMED LOSS OF CELLULAR DIFFERENTIATION THEORY OF AGING

Keep checking back as this post is often updated! Updates usually added at the end.

MAKE SURE YOU CHECK OUT UPDATE #9 – It is amazing! #13 is pretty cool too!

Before we get started let me just whet your appetite about what is contained in the rest of this article. The results of the most important study on aging EVER, that will be the most important study of aging for all time- have just been released! Steve Horvath’s :

Universal DNA methylation age across mammalian tissues

The study proves conclusively that aging is selected for by evolution and is programmed. A result that contradicts all major mainstream theories of aging that have been proposed since the early 1900’s. It turns out August Weisman got the right answer in 1882 but with the wrong reasoning.

The new study also reveals the true cause of aging at the cellular level- the programmed loss of cellular differentiation.

Recently, a preprint of a journal article that is expected to be published in Nature, was released that completely breaks open the cause of aging in mammals of almost all species. The paper shows that this aging is highly conserved by evolution and ends the debate about whether aging is caused by accidental DNA damage or is programmed. The answer?- aging evolved, is highly conserved, and is programmed- no doubt about it!

The paper was lead-authored by Steve Horvath and co-authored with a long list of collaborators. It is currently titled>> Universal DNA methylation age across mammalian tissues.

I think it is the most important study concerning aging and always will be. And I have been studying aging for 35+ years and have seen almost everything! Horvath’s travels through the methylation of the DNA of so many animals is certainly as important as and probably more so than Darwin’s 5 years on the HMS Beagle.

In the last sentence of his abstract Horvath bravely states-

“Collectively, these new observations support the notion that aging is indeed evolutionarily conserved and coupled to developmental processes across all mammalian species – a notion that was long-debated without the benefit of this new and compelling evidence.”

NOT ONLY IS THIS THE MOST IMPORTANT STUDY CONCERNING AGING EVER- IT ALSO PROVES

THE MAINSTREAM SCIENCE’S VERSION OF THEORY OF EVOLUTION IS WRONG!

All those evolution professors are going to have to go back to the drawing board because in their view of evolution it is impossible for aging to have evolved and be selected for because it is bad for the spread of your selfish genes! Virtrually all evolutionary biologists believe that aging being selected for by evolution is impossible!

Actually, I propose in another article with a link at the end of this one, that the selfish gene theory of evolution is mostly correct but it is only half the story. There is a missing half of the theory of evolution that has yet to be revealed. I take a stab at it, and succeed, in the article linked to at the end. Okay back to aging…

Here is a summary of what Horvath et al found:

Horvath and this team looked at the DNA of a large number of mammals and determined what were the genes that experienced major changes of DNA methylation (both increases and decreases) at older ages. Increased methylation at the beginning of a gene would basically shut it down, removal of methylation from the beginning of a gene would allow that gene to be expressed at older ages

They looked at the DNA methylation changes with age in 59 different tissue types from 128 mammalian species to see what they all had in common.

They found a highly conserved aging program driven by DNA methylation changes that for the most part shut down genes that produced transcription factors by adding methyl groups to the promoter area of the genes. They found 36 genes that were affected /shut down by DNA methylation and almost all of them were transcription factors that are involved in the differentiation of cells during development that have homeobox domains. They found very few genes that experienced loss of methylation which was a surprise to me based on my predictions in my 1998 paper . I expected it to be the other way around because the entire genome loses a lot of methylation during aging. So, these instances of hypermethylation must be very special to buck the overall trend in the global DNA demethylation with age, apparently most DNA methylation is uninvolved with direct aging control.

Overall, they found 3,617 cases of hypermethylated cytosines in the DNA associated with aging and only 12 hypomethylated cytosines! This blew my mind.

Well, those 12 hypomethylated sites must be next to some very interesting genes! They analyzed these hypomethylated genes and found the #1 gene that was most hypomethylated in liver and #2 across all tissue types was the LARP1 gene. This gene being more expressed at older ages must be doing something very naughty! Let us take a look at the LARP 1 gene’ function as described by Wikipedia>>>>

Well, what do you know?? LARP1 has a unique region that binds to RNA transcripts! My guess is that this is the protein that is involved in truncating the Lamin A protein in normally aging cells, and likely it is truncating the WRN protein in normally aging cells (truncated WRN protein being found in normally aging and senescent cells has yet to be shown true-but I predict someday this will be found to be occurring).

(If this LARP1 info is boring to you now you can skip over it to get to the good stuff and come back later!)

From Wikipedia, the free encyclopedia

La-related protein 1 (LARP1) is a 150 kDa protein that in humans is encoded by the LARP1 gene. [5] [6] [7] LARP1 is a novel target of the mammalian target of rapamycin complex 1 (mTORC1) signaling pathway, a circuitry often hyperactivated in cancer which regulates cell growth and proliferation primarily through the regulation of protein synthesis. [8]

LARP1 is the largest of a 7-member family of LARP proteins (others are: LARP1B, LARP3 (aka genuine La or SSB), LARP4A, LARP4B, LARP6 and LARP7). [9] All LARP proteins, including human LARPs, contain 2 conserved regions. The first conserved region shares homology with La proteins (called the La motif, see SSB) whereas the second conserved region (called the LA- motif) is restricted to LARP proteins. LARP1 and 1B also contain a conserved “DM15 region” within their C-terminus. [10] This region is unique and has been shown to be required for RNA-binding.Mouse Larp1 is expressed in dorsal root ganglia and spinal cord, as well as in developing organs characterized by epithelial–mesenchymal interactions. [6] Human LARP1 is present at low levels in normal, non-embryonic cells but is highly expressed in epithelial cancers (such as ovarian, colorectal, prostate, non-small cell lung, hepatocellular and cervical cancers). [11] [12] [13] [14] Some studies have shown that high levels of LARP1 protein correlate with worse prognosis in cancer patients. [15] [16]

LARP1 binds to and regulates the translation of terminal oligopyrimidine motif (TOPmRNAs) and can directly interact with the 5′ cap of mRNAs. [17] [18] It has also been shown to interact with the 3′ end and coding regions (CDS) of other genes. [17] LARP1 protein colocalizes withstress granules and P-bodies, [19] which function in RNA storage and degradation. It has been suggested that LARP1 functions in P-bodies to attenuate the abundance of conserved Ras–MAPK mRNAs. The cluster of LARP1 homologs may function to control the expression of key developmental regulators. [19]

Several studies have demonstrated that LARP1 deficiency selectively affects the recruitment of TOP mRNAs to polysomes In some cancer cells, LARP1 deficiency reduces proliferation and activates apoptotic cell death. [13] Even though a decrease abundance of proteins encoded by TOP mRNAs has been reported in LARP1 silenced cells, some researchers believe that this can be explained simply by the reduced number of TOP mRNA transcripts in LARP1-deficient cells.

It turns out I predicted most of this long ago in 1998.

In 1998, I published a paper titled “The Evolution of Aging: A New Approach to an Old Problem of Biology”

in Medical Hypotheses Sep 1998.

This paper was the result of almost 10 years of non-stop 7 day a week, feverish research at the Northwestern Medical School library where I read everything I could find about aging. At the end of 10 years, I was like the first paleontologist who had uncovered the complete skeleton of a dinosaur but the bones were strewn about. I had identified almost all the relevant factors related to aging. It was time to put the bones together to see what the dinosaur looked like. Just like that first paleontologist’s attempt, my assembled dinosaur (aging theory) was mostly correct, but there were some bones placed in the wrong position.

Many good predictions came out of the paper which proved to be true such as:

-Aging is driven by the loss of DNA methylation of cytosines (actually driven by cytosine’s gain or loss of methylation (CH3’s)) also known as epigenetics. The next paper confirming this prediction did not come out until 2012 > Aging, rejuvenation, and epigenetic reprogramming: resetting the aging clock. Cell 2012 Jan 20148(1-2):46-57. (written by some guy at Stanford- who did not mention my 1998 paper )

-Alzheimer’s and dementia would be found to be driven by the increase in Luteinizing Hormone that occurs after age 50 in both men and women. Confirmed in 2005 at the NIH>> Evidence for the role of gonadotropin hormones in the development of Alzheimer disease. Cell Mol Life Sci. 2005 Feb62(3):293-8.

-Luteinizing Hormone and Follicle Stimulating Hormone would be found to play a central role in aging . Confirmed >> Data mining of human plasma proteins generates a multitude of highly predictive aging clocks that reflect different aspects of aging. October 2020 Aging Cell 19(1):e13256 ( the #1 and #2 proteins that increase the most in the aging cell are related to LH(#1) and FSH (#2).)

-The Hierarchy of programmed aging control was predicted to be

Hormone Changes>> Loss of Methylation >>> Expression of genes that cause aging.

This study proves this to be true, but to a lesser extent than I expected. What I did not expect was another hierarchy revealed by this study

Hormone Changes >>>> Gain of Methylation >>> Suppression of genes required for cellular differentiation.

-And one more little thing predicted in my 98 paper , that aging EVOLVED and is PROGRAMMED and is controlled by the same things that control development.

-The first 2 sentences in the abstract of my paper claimed that aging evolved and aging and development were intimately linked. This new study proves it to be 100% true.

“The evolution of aging: a new approach to an old problem of biology”

Bowles, JT Medical Hypotheses Sep 98

“Most gerontologists believe aging did not evolve, is accidental, and is unrelated to development.

The opposite viewpoint is most likely correct.”

The problems with the paper were caused by my trying to put all the aging puzzle pieces together without enough information. For example, I imagined that the protein that is defective in Werner’s Syndrome (truncated) was generating excessive free radicals during the DNA unwinding process that catalyzed the demethylation of cytosines in the DNA. I thought this allowed pro-aging genes to be expressed, filling the body with destructive proteins. I received endless ridicule and derision from mainstream aging theorists who believed that the evolution of pro-aging genes was impossible. The new study shows that there are pro-aging genes, just not as many as I had imagined. It turns out that a lot of the programmed aging is caused by the suppression of genes that make transcription factors involved in maintaining cellular differentiation during and after development.

In reality what was happening was that the WRN helicase consists of 6 identical subunits which come together to form a helicase. The job of a helicase is to unwind and rewind the DNA.The single subunit also has another job as a transcription factor that binds to and silences some genes in stem cells to allow them to retain their differentiation and remain stem cells. But this was not known when I wrote the paper, so I gave it my best guess.

See>> A Werner syndrome stem cell model unveils heterochromatin alterations as a driver of human aging Science. 2015 Jun 5 348(6239): 1160–1163.

Werner syndrome (WS) is a premature aging disorder caused by WRN protein deficiency. Here, we report on the generation of a human WS model in human embryonic stem cells (ESCs). Differentiation of WRN-null ESCs to mesenchymal stem cells (MSCs) recapitulates features of premature cellular aging, a global loss of and changes in heterochromatin architecture. We show that WRN associates with heterochromatin proteins SUV39H1 and HP1α and nuclear lamina-heterochromatin anchoring protein LAP2β. Targeted knock-in of catalytically inactive SUV39H1 in wild-type MSCs recapitulates accelerated cellular senescence, resembling WRN-deficient MSCs. Moreover, decrease in WRN and heterochromatin marks are detected in MSCs from older individuals. Our observations uncover a role for WRN in maintaining heterochromatin stability and highlight heterochromatin disorganization as a potential determinant of human aging.

“Finally, we asked whether heterochromatin disorganization could be a common hallmark for physiological human stem cell aging. For this purpose, we compared the levels of heterochromatin marks in primary dental pulp MSCs derived from six young (7–26 year old) and six old (58–72 year old) individuals (fig. S10I, and Table S4) (20). A marked downregulation of WRN protein associated with a decrease in H3K9me3, HP1α, SUV39H1, and LAP2β levels in MSCs derived from old individuals (Fig. 4E). Therefore, specific heterochromatin changes may underlie both pathological as well as physiological mesenchymal stem cell aging.

In summary, we have found that WRN protein, besides its role in DNA repair, functions to safeguard heterochromatin stability (fig. S11). Our results unveil that the progressive heterochromatin disorganization observed in WRN deficient MSCs underlies cellular aging, but more extensive studies are needed to examine its role during physiological aging.”

Werner’s Syndrome is a rapid aging disease that kicks in around puberty and leads to thoroughly aged people by the age of 45 or so>>

Werner’s Syndrome is caused by the WRN protein being improperly truncated so that it is too short to do its job properly of preserving the differentiation status of human stem cells.

Werner’s Syndrome is very much the same as normal aging. These patients have all the classic signs of aging , but they also have some extra-rare forms of disease which is what has led scientists to try and claim that this was not real aging. WS patients are afflicted with quite a few rare cancers as well as the normal aging processes.

I believe that the excess of rare cancers and other oddities associated with WS are caused not by the single truncated protein which causes all the features of normal aging, but rather by the improper functioning for the DNA helicase made by the 6 identical but defective WRN helicase subunits. Because proper functioning of DNA helicases are required for proper DNA maintenance and repair, it is not surprising that defective helicases would be associated with various odd forms of cancer.

(To my knowledge, truncated WRN protein being found in normally aging and senescent cells has yet to be discovered-but I predict someday this will be forthcoming).

The truncated differentiation/helicase protein found in Werner’s Syndrome is similar in concept to the disease called progeria which attacks young children from the time they are born and turns them into very old decrepit individuals by the age of 12 or so where they usually die of heart disease or atheroscelrosis. Progeria is also caused by a truncated protein , the Lamin A protein which is a protein that is found in the nuclear envelope inside the cell. I proposed that progeria recapitulates many of the aging symptoms seen at a higher rate in normally aging males.

The truncated Lamin A protein causes the envelope that surrounds the DNA in the nucleus to be misshapen>>

Normal Nucleus Progeria Nucleus

What is not that well known is that the progeria Lamin A protein has a 2 nd function of binding to the DNA to act as a transcription factor that silences various genes so that various cells maintain their differentiation with the proper gene expression profile (for example so that a skin cell remains a skin cell by keeping a certain set of genes silenced).

See UPDATE #12 at the end of this article- it turns out that Lamin A is NOT expressed in induced pluripotent stem cells (undifferentiated cells) and the nucleus of these undifferntitated cells looks a lot like the nucleus in progeria cells! This gives further weight to the idea that aging is caused by loss of cellular differentiation.

Well, it turns out that this truncated Lamin A protein is not unique to progeria kids but is also seen in normal aging at older ages in normal adults! It is found in senescent cells in normal humans- there are a number of studies on this for example>>>

Published online 2007 Dec 5.

The Mutant Form of Lamin A that Causes Hutchinson-Gilford Progeria Is a Biomarker of Cellular Aging in Human Skin

Abstract Hutchinson-Gilford progeria syndrome is a rare disorder characterized by accelerated aging and early death, frequently from stroke or coronary artery disease. 90% of HGPS cases carry the LMNA G608G (GGC>GGT) mutation within exon 11 of LMNA, activating a splice donor site that results in production of a dominant negative form of lamin A protein, denoted progerin. Screening 150 skin biopsies from unaffected individuals (newborn to 97 years) showed that a similar splicing event occurs in vivo at a low level in the skin at all ages. While progerin mRNA remains low, the protein accumulates in the skin with age in a subset of dermal fibroblasts and in a few terminally differentiated keratinocytes. Progerin-positive fibroblasts localize near the basement membrane and in the papillary dermis of young adult skin however, their numbers increase, and their distribution reaches the deep reticular dermis in elderly skin. Our findings demonstrate that progerin expression is a biomarker of normal cellular aging and may potentially be linked to terminal differentiation and senescence in elderly individuals. “

So, in both cases of Werner’s Syndrome and progeria we find a truncated protein that is used for differentiating cells is defective and unable to properly do its job of maintaining the differentiated state of the cell.

So, what could have been predicted from these facts?

That aging is caused by nothing more than cells losing their differentiation or becoming de- differentiated as I state in the title of this article. In reality, this should have been predicted long ago after studying Werner’s Syndrome and progeria. This prediction could have easily been made in 2014 and probably earlier after studies came out showing that Lamin A protein was involved in maintaining cellular differentiation in stem cells.

See> Gerontology. 201460(3):197-203. Epigenetic involvement in Hutchinson-Gilford progeria syndrome: a mini-review

Take a skin cell for example, as it loses the factors that are suppressing genes that are not involved with being a skin cell, the cell starts adopting a more and more unusual (undifferentiated) phenotype.

If the process were to continue long enough the skin cell would be unrecognizable eventually. In some ways you could say the skin cell is returning to its undifferentiated, earlier (younger) state, but in an unhealthy way that ends up killing the bearer of these undifferentiated cells throughout the body. Counterintuitively, detrimental aging appears to actually be caused by cells becoming younger in a way, less differentitated, more like an embryonic stem cell!

I theorized in my 1998 paper, that more primitive organisms , early in evolution, probably reproduced in this manner- a quote-

“At this point in evolution, reproduction likely occurred through parthenogenesis and possibly the complete dissociation of the multi-celled organism into a myriad of single cell, clonal spores in an unrestricted environment, this would provide a great reproductive advantage.”

And it turns out that there are still animals on earth that can reproduce this way..take the immortal jellyfish for example:

From National Geographic Magazine-

How the Jellyfish Becomes “Immortal”

“Turritopsis typically reproduces the old-fashioned way, by the meeting of free-floating sperm and eggs. And most of the time they die the old-fashioned way too. But when starvation, physical damage, or other crises arise, “instead of sure death, [Turritopsis] transforms all of its existing cells into a younger state,” said study author Maria Pia Miglietta, a researcher at Pennsylvania State University. The jellyfish turns itself into a bloblike cyst, which then develops into a polyp colony, essentially the first stage in jellyfish life. The jellyfish’s cells are often completely transformed in the process. Muscle cells can become nerve cells or even sperm or eggs. Through asexual reproduction, the resulting polyp colony can spawn hundreds of genetically identical jellyfish—near perfect copies of the original adult.”

It appears that our human development/ aging program of increasing differentiation then decreasing differentiation probably evolved from this ancient form of a reproduction system. Instead of a human dissolving into 30 trillion identical clonal spores to reproduce (which one would expect to happen if the selfish gene theory of evolution was the only way evolution worked), we instead lose our cellular differentiation in a way that harms and eventually kills. We might go so far to say that we age by getting younger from a differentiation point of view!-talk about an unexpected conclusion!

If this concept is correct then we can expect that with the addition of a number of healthy transcription factors back to an older cell that it could be made younger, and this has indeed been proven to be the case. All that was needed were the four transcription factors known as Yamanaka factors to reverse aging in the cell dramatically. The first experiment with Yamanaka factors took an adult cell and reprogrammed it all the way back to an embryonic state. They later just subjected an adult cell to transient expression of the Yamanaka factors and were able to make the cell significantly younger, but not return all the way to embryo status.

See> Cell. 2016 Dec 15 167(7): 1719–1733.e12 .In Vivo Amelioration of Age-Associated Hallmarks by Partial Reprogramming

“Aging is the major risk factor for many human diseases. In vitro studies have demonstrated that cellular reprogramming to pluripotency reverses cellular age, but alteration of the aging process through reprogramming has not been directly demonstrated in vivo. Here, we report that partial reprogramming by short-term cyclic expression of Oct4, Sox2, Klf4, and c-Myc (OSKM) ameliorates cellular and physiological hallmarks of aging and prolongs lifespan in a mouse model of premature aging. Similarly, expression of OSKM in vivo improves recovery from metabolic disease and muscle injury in older wild-type mice. The amelioration of age-associated phenotypes by epigenetic remodeling during cellular reprogramming highlights the role of epigenetic dysregulation as a driver of mammalian aging. Establishing in vivo platforms to modulate age-associated epigenetic marks may provide further insights into the biology of aging.”

Okay, so here is another a little prediction that could be made:

If aging is caused by the loss of differentiation in your cells, then one would expect to see genes that produce transcription factors shut down. Also, thinking back to Werner’s Syndrome and progeria we would also expect to see some sort of pro-aging related protein unleashed that leads to truncated differentiation proteins like Lamin A and WRN.

What kind of gene product would we be looking for that truncates differentiation proteins? The easiest way to truncate proteins would not be at the protein level, but rather at the mRNA level. The way proteins are produced is that the genes in our DNA are read and copied to a very similar molecule called mRNA which is almost identical to DNA with the exception of using the base pair Uracil in place of Thymine in the GCAT alphabet of your DNA. The only difference between Uracil and Thymine is a single methyl group (CH3) which is found attached to the 5’ carbon in thymine but only an H is attached to the 5’ carbon in uracil.

Prediction: There should exist some sort of protein that truncates mRNA transcripts at inappropriate places that increase with age to cause impairment of various differentiation proteins like WRN and Lamin A. This would be a lot easier that cutting the proteins after they have already been made. In fact, I did make this prediction to a pair of researchers who were able to rejuvenate old mice by removing half their blood plasma and replacing it with saline and albumin. I suggested they look for an aging-promoting RNA-ase that ran around truncating mRNA transcripts in inappropriate places-I never heard back from them.

Well as mentioned before, LARP1 seems to fit the description of this hypothetical protein! It has a very unique sequence that is specific for binding to RNA transcripts. It is found at high levels in cancers. Werner’s Syndrome victims suffer from normal cancers at a high rate as well- is LARP1 cleaving the WRN protein which leads to cancer?

So, the bottom-line conclusions we can draw from this amazing new study are these:

  1. Because the large set of genes shut down by methylation during the aging process (as well as the upregulated LARP1 gene( a true aging gene) ) are primarily the same across all mammalian species it very, very, strongly suggests that aging evolved and is highly conserved. This is in complete contradiction to modern mainstream evolutionary theory which proclaims that aging could never have evolved because it is bad for the individual and reduces the spread of the individual’s genes. For most modern aging theorists, they think an evolved aging program is something akin to a perpetual motion machine, completely impossible. In fact, this was once the quote by Aubrey De Gray in his sophomoric paper about how programmed aging was impossible.

See> Calorie restriction, post-reproductive life span, and programmed aging: a plea for rigor. Grey AD, Ann N Y Acad Sci. 2007 Nov1119:296-305.

Please Notice I did not cross out the hormonal/neuroendocrine theory of aging…that one is still valid and will be found to be the upstream controller of the programmed loss of cellular differentiation primarily through the large/dramatic post age 50 increases in LH, FSH, and hCG with the simultaneous dramatic decline in night time melatonin peaks, dhea, pregnenolone, and progesterone.

Interestingly, melatonin has been found to do all sorts of amazing things, like reversing recent onset menopause (probably due to melatonin’s ability to suppress LH and FSH), preventing the progression of Alzheimer’s, increasing dramatically during caloric restriction, acting as birth control in women at 75 mg per night, and even extending the lives of mice by 20%. I can easily imagine that melatonin somehow has a central role in maintiaing the methylated status of the circadian rythym and Alzheimer’s genes that become hypomethylated during aging (Horvath found these in the small group of genes that get activated with aging along with LARP1).

A quick Pub Med search of the terms “melatonin AND DNA AND methylation” gives you 96 studies , most of which show that melatonin is intricately involved with DNA methylation, and the decline of melatonin with age might be the reason for the global hypomethylated status of DNA in the elderly. Studies with titles such as>> Melatonin and sirtuins: A “not-so unexpected” relationship., or Neuroendocrine aging precedes perimenopause and is regulated by DNA methylation Melatonin-induced demethylation of antioxidant genes increases antioxidant capacity through RORalpha in cumulus cells of prepubertal lambs, Melatonin-Mediated Development of Ovine Cumulus Cells, Perhaps by Regulation of DNA Methylation, Melatonin restores the pluripotency of long-term-cultured embryonic stem cells through melatonin receptor-dependent m6A RNA regulation (of Yamanaka factors) are not uncommon.

There are numerous studies showing that progesterone, testosterone, and estrogen have dramatic effects on DNA methylation.

I also did not cross out the telomere theory of aging. However, this theory becomes just a subset of the loss of cellular differentiation theory of aging in that telomeres when they are long, fold back over on the coding DNA and suppress various genes, probably aging genes. As the telomere shortens, these genes are then expressed. This is called the telomere position effect. (Maybe the genes that , when expressed, lead to the methylation/suppression of those 36 transcription factor genes might be found here-( However I kind of doubt it because mice have been shown to have no increase in aging symptoms after their telomerase gene is knocked out and they have continually shortening telomeres. The only aging symtoms that show up in the experimental mice occur in the 4th generation when they start showing hair-graying, alopecia, and infertility-see DePinho)).

Also, Horvath noted that some other genes that were hypermethylated and thus shut down were a group of genes involved with the circadian rythym. This suggests to me a connection to melatonin and other hormones that vary throughout the day. He noted another set of genes involved with causing Alzheimers disease that also lose methylation and are more highly expressed. (This might explain why melatonin seems so effective at stopping the progression of Alzheimers).

So of course this study raises the important question-What is the purpose of the evolution of programmed aging and how could it evolve?

A brief article about how evolution can select FOR aging>>

Or a more in depth book on the topic>>>>

Update 1. The recent study where 50% of the blood plasma of mice was replaced with saline and albumin which led to a dramatic rejuvenation of the mice earlier was suggested herein to possibly be caused by a reduction of the LARP1 protein. However, what if LARP1 protein does not circulate in the blood but is only found inside the cell nucleus? What else could be being removed from the blood that stops the aging process and allows rejuvenation to happen? How about a 50% reduction in the circulating gonadotropins LH, FSH, and hCG ? These are the pro-aging hormones that increase with age by hundreds of percent and even up to 1,000% in women and men after age 50.

Update 2. It is interesting to note how babies often look so much alike due to their not being fully “differentiated”. They are much more unique and differentiated as children and adults. But then think of the elderly don’t they seem to be very similar looking? Is this an example of a gain then a loss of cellular differentiation manifesting itself in physical appearance?


Update 3- It appears this aging system is kind of a case of antagonistic pleiotropy (AP). How? It is a new kind of AP where something that was good for your distant ancestors (dissolution of the organism into millions of billions of single cell clones that can each grow into a new adult) from an evolutionary perspective, evolves into something that is bad for the more modern descendents of the ancestral species. The ancient, dramatically prolific system of reproduction has evolved into something that now kills an individual at a programmed time.

Update 4– If progeria and Werner’s Syndrome are both manifestations of a malfunctioning development/differentiation program we can make two very important observations:

  1. The genes silenced by the lamin a protein that is defective in progeria, are most likely the same genes that control the developmental changes where an infant develops into a prepubescent juvenile. (Keep in mind that progeria begins at birth) and
  2. The genes silenced by the WRN protein that is defective in Werner’s Syndrome, are most likely the genes that control the developmental changes where a prepubescent juvenile develops into a fully sexually developed/differentiated fertile adult. (Remember that Werner’s Syndrome does not kick in until puberty begins).

Update 5- For decades if not a century, evolutionary biologsists and gerontologists, in order to maintain the illusion that aging is not programmed and was not selected for have had to hide certain facts that just screamed out “aging is programmed!”. The two diseases that are the main topic of this article, Werner’s Syndrome, and progeria have been referred to over and over as “not real examples of aging” because they are caused by genetic mutations and have a few differences when compared to regular aging . This is especially true in the case of Werner’s disease where a 50 year old woman will look almost identical to a nornally aging 85 or 90 year old woman! Because Werner’s Syndrome patients have a higher incidence of some rare cancers – scientists of the past have relied on this canard to declare Werner’s Syndrome is not a case of accelerated programmed aging. With the programmed loss of cellular differentiation theory of aging we can finally do away with this pretense.

Another glaring fact that screams “aging is programmed” is the existence of semalparous aging. The most famous example consists of the rapid aging and death of the Pacific Salmon immediaely after breeding around the age of three years old. When the Pacific Salmon is castrated , it can live 7 or more years. How was this explained using the other theories of aging of the past? Simply by saying semelparous aging is not a real form of aging and can be ignored! It had long been hypothesized that the rapid aging and death of the Pacific Salmon was caused by its huge exertion of energy and large amounts of resources spent in traveling the long journey from the ocean to its riparian birthplace to reproduce. Some suggested that the Salmon just died of exhaustion. Others made a slightly less simple case and suggested that the hormonal changes occuring during the great trip of the Salmon led to very high levels of the stress hormone cortisol. Supposedly that was what was killing them, although the cortisol increase comes long before they reproduce.

Well, recently Craig Atwood did a study of changes in the pro-aging hormones LH and FSH various species including the semelparous Salmon. Altough apparently he could not find any data on changes in LH levels in Salmon he did find that FSH levels skyrocket 4,500% post reproduction as compared to even the high level reached in humans after age 50 of about a 500% increase.

I would like to point out to Craig that there is a 1998 study on hormone changes in Salmon that shows LH levels skyrocket as well. Biol Reproduction 1998 Mar58(3):814-20. B. Borg et. al.

So the bottom line here is we see that semelparous species no longer have to be put in a special category and hidden away and ignored as not related to normal aging. Rather they now provide a somewhat typical case of programmed aging being driven by the post reproductive dramatic increases in FSH and LH seen also in humans and most other animals from fish to mammals to birds, etc. The salmon are only unusual in the speed at which they age and the height to which their LH and FSH levels can reach.

Now this one really gets into the weeds of this theory-probably not suitable for the casual reader:

It is interesting to consider these two abstracts concerning menopause, hormones and methylation>

Significance

Within an evolutionary framework, aging and reproduction are intrinsically linked. Although both laboratory and epidemiological studies have observed associations between the timing of reproductive senescence and longevity, it is not yet known whether differences in the age of menopause are reflected in biomarkers of aging. Using our recently developed biomarker of aging, the “epigenetic clock,” we examined whether age at menopause is associated with epigenetic age of blood, saliva, and buccal epithelium. This is a definitive study that shows an association between age of menopause and biological aging (measured using the epigenetic clock). Our results also indicate menopause may accelerate the epigenetic aging process in blood and that age at menopause and epigenetic age acceleration share a common genetic signature.

Neurobiol Aging 2019 Feb74:213-224.

Neuroendocrine aging precedes perimenopause and is regulated by DNA methylation
Abstract

Perimenopause marks initiation of female reproductive senescence. Age of onset is only 47% heritable suggesting that additional factors other than inheritance regulate this endocrine aging transition. To elucidate these factors, we characterized transcriptional and epigenomic changes across endocrine aging using a rat model that recapitulates characteristics of the human perimenopause. RNA-seq analysis revealed that hypothalamic aging precedes onset of perimenopause. In the hypothalamus, global DNA methylation declined with both age and reproductive senescence. Genome-wide epigentic analysis revealed changes in DNA methylation in genes required for hormone signaling, glutamate signaling, and melatonin and circadian pathways. Specific epignetic changes in these signaling pathways provide insight into the origin of perimenopause-associated neurological symptoms such as insomnia. Treatment with 5-aza-2′-deoxycytidine, a DNA-methyltransferase-1 inhibitor, accelerated transition to reproductive senescence/ whereas supplementation with methionine, a S-adenosylmethionine precursor, delayed onset of perimenopause and endocrine aging. Collectively, these data provide evidence for a critical period of female neuroendocrine aging in brain that precedes ovarian failure and that DNA methylation regulates the transition duration of perimenopause to menopause.

Once evolutionary biologists realize that there is something more going on to drive evolution than the selfish gene, once they realize there are evolutionary forces that also limit the spread of an individual’s genes for the good of the species which I describe in my article “Sex & Aging , How Evolution Selects For Them Almost Everywhere All the Time” many enduring mysteries of evolution can be easily explained. For example, here is a large portion of the chapter on homosexuality in my book “What Darwin Could Not See- The Missing Half of the Theory”:

CHAPTER 6: The Sixth Puzzle Piece-Homosexuality In Animals & Humans

One would think that anyone defending the primacy of the selfish gene as the major driving force behind all of evolution would have some sort of reasonable explanation for how something as widespread as human homosexuality could evolve.

Homosexuality is a condition where the possessor of the homosexual trait will, if left to nature only, will choose to never have sex with the opposite sex and thus not have any offspring and not pass on a single gene to the gene pool! Yet human homosexuality exists and has persisted throughout history.

Certainly, this must be harder for selfish gene promoters to explain than sex. At least with sex, the reproducer gets to pass on half of his or her genes. Here the selfish gene-ist has to explain how it evolved that someone passes on NO GENES WHATSOEVER! Given the very tough problem to solve here, the topic of homosexuality is just ignored for the most part, by evolutionary biologists.

Richard Dawkins, as courageous as he is, at least gives an explanation a try in a 2015 YouTube video. I share the link with you below. If you want a good laugh give it a watch. I am not laughing at Dawkins himself just at him trying to perform the impossible task of explaining homosexuality from the selfish gene point of view.

Darwin Day 2015 Questions: #4 How does evolution explain homosexuality?

After viewing this I think Dawkins might seem to focus more on male than female homosexuality and was so bold as to suggest that bottle feeding babies (male I presume) might make them more inclined to be homosexual. I am guessing he thinks sucking on a rubber nipple trains the young lad to want to suck on other protuberances?

Biologists in general tend to also discuss the evolutionary puzzle of homosexuality as mainly a human condition. Applying it to just humans makes the fact conveniently unique and a special category that can be ignored. They do it all the time. Menopause and suicide are also promoted by most biologists as being exceptions that apply to just humans.

Well it turns out that humans aren’t the only ones where homosexuality is common.

There are some estimates that up to 1500 species have been documented to have homosexual individuals in their numbers! If you just do a quick perusal of the Wikipedia entry for homosexuality in animals, you will get all sorts of examples.

So apparently, homosexuality cannot be dumped into the unique human exception category and thus can no longer be ignored by biologists. It must be addressed trying to address it from the perspective of the preeminence of the selfish gene just leads us into another blind alley with no way out.

What the Wikipedia entry fails to describe are the conditions affecting the pregnant mother of future homosexual offspring.

A number of studies in rodents have shown that if you stress the pregnant mother at certain times during her pregnancy she will tend to give birth to homosexual males and promiscuous females and a smaller number of homosexual females.

What is this telling us from the perspective of the BIG PICTURE? What causes stress? Too many close encounters with predators. This fits quite easily into the BIG PICURE of most unexplained biological phenomenon as being defenses to evolving predation.

How is having homosexual offspring a defense to predation? Having homosexual offspring is a form of birth control for mothers who are considered by evolution to be unfit in the presence of predation. The stress from predator encounters if extreme enough can kill the mothers and their unborn babies. If the stress is less extreme it can lead to homosexual offspring that need to be nursed for a relatively significant period of time. Nursing prevents the mother from becoming fertile for mating. So, in a sense having homosexual offspring is just nature’s form of birth control for mothers perceived as temporarily “unfit” due to stress.

Let us consider the case of female offspring of stressed mothers being more promiscuous than the female offspring of non-stressed mothers. This also jibes well with the BIG PICTURE as promiscuous females who have offspring from multiple males rather than bonding with a single one will add more diversity to the gene pool than if she just mated with a single male for life. As we will see later diversity in the gene pool is the defense to evolving predation that evolution seeks with all these mysterious adaptations.

Now we get to humans is there any evidence that stressing pregnant female humans can cause their male offspring to be born as homosexual? I wrote about this topic in my December 2000 paper published in Medical Hypotheses titled “Sex, Kings, & Serial Killers and other Group Selected Traits”

Homosexuality: Birth Control for “Unfit” Mothers?

Prevailing evolutionary theory cannot explain the conundrum of homosexuality. Current theory requires defining homosexuality as an evolutionary accident as homosexual offspring would not be expected to reproduce. Is evolution so sloppy that the sexual preferences of 10% to 20% of the human population (78) is simply a random mistake of nature? And why does it also occur throughout the animal kingdom from sheep (79) on down to rats (80)? If one accepts group selection as a reality, the purpose of homosexuality has a simple explanation.

Various studies show that when stressed at a certain time during gestation, rats give birth to males that exhibit female behavior and females that are more masculine (81). (The literature is relatively conclusive on this for males, but the data on females is somewhat ambiguous. Some female offspring of stressed rats also show more promiscuous mating behavior). Stress increases cortisol levels in rats, and the Prior Paper referred to studies showing that cortisol appears to oppositely affect the sex hormones in human females and males which we will assume extends to rats.

If stress induces high maternal cortisol levels during gestation and the cortisol reaches the developing embryo, endogenous embryonic sex hormones may be altered. Testosterone and estradiol levels in male and female embryos respectively may be decreased. Decreased embryonic sex hormones likely affect the development of the brain’s sexuality. It has been shown that the prenatal stress-induced feminization of male rats is prevented by perinatal androgen treatment (82).

Studies have shown that human females, male transsexuals, and homosexuals share similarities in certain brain structures which differ with heterosexual males (83, 84). Also, it is believed that testosterone derived DHT is required during fetal brain development to create a “male brain” (85). Likewise, we might assume that estradiol exposure creates a “female brain” by feminizing some brain structures. If a stress-induced maternal cortisol surge suppresses the embryo’s testosterone or estradiol, then homosexual offspring, of either sex could result. Interestingly, some researchers found that in a large group of homosexuals interviewed in Germany, many more were born during the war years of 1941 to 1947 than before or after this stressful period with the birth peak occurring in 1944-1945 (86).

Why would evolution create such a system? If a pregnant female is stressed in the wild, it may imply close encounters with predators or maladaptation to her group. Evolution, through group selection, has likely selected for groups that remove or inhibit the spread of her “less fit” genes. While a spontaneous miscarriage or stressed-induced cannibalization of her young (which is common in rodents) is a simple solution, it would leave the female ready to reproduce again. A more clever and effective solution is to give her effectively sterile offspring which she will raise, and which will keep her from reproducing much longer than if she were childless. Also, if group survival required the homosexual children to reproduce, homosexual females could be forced to have sex by dominant heterosexual males. Homosexual males, however, who could not be forced, are evolutionarily irrelevant anyway as long as a single heterosexual male existed.

The only attempt at an evolutionary explanation of homosexuality that the author could find was one that proposed that a homosexual male child would be generated if it was prenatally stressed. The stressor was assumed to be the mother’s living in a crowded environment. The homosexual male, as an adult would not reproduce so that in times of famine there would be fewer grandchildren, and thus an increased likelihood of the grandchildren’s survival (87). One does not have to work long to find counter arguments to this reasoning, but it is a creative attempt to overcome the conundrum of homosexuality and borders on using group selection as an argument. It is only referenced here to show the difficulties that exist in trying to explain homosexuality without the unabashed acceptance of some form of group selection.

(Recent note-which we will later find this to be not group but an even higher-level form of selection called species selection which I have refined and coined the name “Predator Selection”).

One must wonder about the seemingly high levels of human homosexuality. Were so many mothers severely stressed by predators or wars during pregnancy? Not likely. However, a source of artificial stress has been unleashed this century on humans in epidemic proportions: cigarette smoking. Nicotine from smoking induces a significant increase in cortisol levels. If a pregnant female has the genetic predisposition to bear homosexual children when stressed, and she smokes during early pregnancy, the nicotine-induced cortisol increase may be sufficient to induce homosexuality in her offspring. This speculation could easily be confirmed or refuted with a simple epidemiological study.

  1. Sell R. Wells J. Wypij D. The prevalence of homosexual behavior and attraction in the United States, the United Kingdom, and France: results of national population-based samples. Archives of Sexual Behavior 24(3). 1995. 235-248.
  2. Perkins A. Fitzgerald J. Moss G. A comparison of LH secretion and brain estradiol receptors in heterosexual and homosexual rams and female sheep. Hormones & Behavior 29(1). 1995. 31-41.
  3. Ferguson T. Alternative sexualities in evolution. Evolutionary Theory 11(1). 1995. 55-64
  4. Ohkawa T. Sexual differentiation of social play and copulatory behavior in prenatally stressed male and female offspring of the rat: the influence of simultaneous treatment by tyrosine during exposure to prenatal stress. Nippon Naibunpi Gakkai Zasshi-Folia Endocrinolgica Japonica. 63(7):823-35, 1987 Jul.
  5. Dorner G. Gotz F. Docke W. Prevention of demasculization and feminization of the brain in prenatally stressed male rats by perinatal androgen treatment. Experimental & Clinical Endocrinology. 81(1):88-90 1983 Jan.
  6. Swaab D. Gooren L. Hofman M. Gender and sexual orientation in relation to hypothalamic structures. Hormone Research. 38 Suppl 2:51-61, 1992.
  7. Zhou J, Hofman M. Gooren L. Swaab D. A sex difference in the human brain and its relation to transsexuality. Nature. 378(6552):68-70, 1995 Nov.
  8. Connolly P. Choate J. Resko J. Effects of endogenous androgen on brain androgen receptors of the fetal rhesus monkey. Neuroendocrinology. 59(3):27 1994 Mar.
  9. Dorner G. et.al. Prenatal stress as possible aetiogenetic factor of homosexuality in human males. Endokrinologie.75(3):365-8, 1980 Jun.
  10. 81.

-END Excerpt from my 1998 paper-

(A natural born homosexual?)

While searching for the old studies that showed a sharp rise in the birth of homosexuals in Germany during the WWII years (this supposedly also happened in England as well amongst the pregnant women who hid in London’s subway tunnels during the German bombing campaigns) I found an article about a new book by Dr. Dick Swaab, a well-known neuroscientist who is best known for his research and discoveries in the field of brain anatomy and physiology, in particular the impact that various hormonal and biochemical factors in the womb have on brain development. The book is called “We Are Our Brains” and he puts forth the controversial “new” idea that homosexuality occurs in the brains of fetuses in the womb of stressed mothers. He also notes, like I did in my 2000 paper, that smoking by pregnant mothers can lead to homosexual offspring because nicotine stimulates the release of the stress hormone cortisol and in effect acts as a predator encounter as perceived by evolution. He does add some new evidence that stress in mothers causes homosexuality by noting, as one would expect, that amphetamines (also fake stress) and various other substances lead to an excess of homosexual offspring.

So, that’s about it for homosexuality. If we have learned another fact about evolution, we can say that homosexuality fits in to the big picture as follows:

-Homosexuality is birth control for mothers perceived as stressed by evolution and thus possibly having less than optimal genes for the particular environment. Having an effectively “sterile” child reduces her potential contribution to the gene pool by preventing her from getting pregnant while nursing, and investing resources into the sterile child which also reduces her total potential reproductive output.

One more Thing-Dr. Dick Swaab, for some reason is getting death threats from some gay people who don’t like homosexuality being portrayed as a pathology! I guess they want to think it is a choice. But if you ask most gay people they are happy to say they were born that way. So please don’t send me any death threats thank you.

One other thing I have seemed to notice is that when you look at large groups of either homosexual males, or homosexual females, the males still tend to maintain their evolved desire to stand out and draw attention to themselves while groups of lesbians seem to act more like the camouflaged females of other species, who desire and have evolved to avoid attention. You can also do a crude test of this idea by searching google-images for group of gay men and then for group of lesbians and you will see the difference. Most of the pictures are along the lines that follow: (see pictures in the book).

Update 9- This is a good one!

While doing research for my 1998 paper- The Evolution of Aging a New Approach to an Old Problem of Biology

I studied all accelerated aging diseases of progeria, the segmental aging diseases caused by various mitochondrial defects, ataxia telangiectasia (AT), Cockayne syndrome (CS) , xeroderma pigmentosum (XP), and Werner’s syndrome and compared them with respect to what aging symptoms they had at an accelerated rate…and made a table to compare them! (see table bleow). You could call this the periodic table of accelerated aging symptoms.

I had designated Werner’s syndrome as the dominant aging system that coopted and controlled all the other aging systems-you will see why when you study the table- but basically because WS shows all the symptoms of normal human aging while other rapid aging diseases just show a segment..

It turns out, I believe, given the connection between development and aging we now understand thanks to Horvath, that the normal Werner’s syndrome protein apparently is also the coordinator and master regulator of all other development genes and transcription factors. The WRN protein does not do all the work itself, it has apparently coopted downstream transcription/differentiation factors and tells them when to be turned on and turned off. WRN is the master regulator of develpoment.

Somehow WRN controls how and when lamin A protein shuts down various genes in its purview, as well as the normal proteins that are defective in the mitochondrial diseases , AT, CS, and XP. Wrn tells them all what to do and when.

It also now reveals , what I believe , is the master plan of how development is regulated and orchestrated as you will soon see- I had an inkling about it when I made the table but I never articulated it. Well hold onto your hats…here it comes>>


Conclusions

We have shown that established pluripotent cells are neoplastic if present after the time when pluripotency is normally shut down, i.e. at organogenesis stages. We also show that reactivation of Oct4, or Oct4 and Nanog, after pluripotency shutdown is not sufficient to reactivate pluripotency in vivo, and requires additional signals from the cellular microenvironment. It will be interesting in future to determine whether sites at which either Activin/Nodal/Fgf or LIF/BMP signalling is naturally present coincide with sites at which teratomas spontaneously arise in mice and humans.


The effects of triclosan on pluripotency factors and development of mouse embryonic stem cells and zebrafish

Triclosan (TCS) poses potential risks to reproduction and development due to its endocrine-disrupting properties. However, the mechanism of TCS’s effects on early embryonic development is little known. Embryonic stem cells (ESC) and zebrafish embryos provide valuable models for testing the toxic effects of environmental chemicals on early embryogenesis. In this study, mouse embryonic stem cells (mESC) were acutely exposed to TCS for 24 h, and general cytotoxicity and the effect of TCS on pluripotency were then evaluated. In addition, zebrafish embryos were exposed to TCS from 2- to 24-h post-fertilization (hpf), and their morphology was evaluated. In mESC, alkaline phosphatase staining was significantly decreased after treatment with the highest concentration of TCS (50 μM). Although the expression levels of Sox2 mRNA were not changed, the mRNA levels of Oct4 and Nanog in TCS-treated groups were significantly decreased compared to controls. In addition, the protein levels of Oct4, Sox2 and Nanog were significantly reduced in response to TCS treatment. MicroRNA (miR)-134, an expression inhibitor of pluripotency markers, was significantly increased in TCS-treated mESC. In zebrafish experiments, after 24 hpf of treatment, the controls had developed to the late stage of somitogenesis, while embryos exposed to 300 μg/L of TCS were still at the early stage of somitogenesis, and three genes (Oct4, Sox2 and Nanog) were upregulated in treated groups when compared with the controls. The two models demonstrated that TCS may affect early embryonic development by disturbing the expression of the pluripotency markers (Oct4, Sox2 and Nanog).

This is a preview of subscription content, access via your institution.


DATA ACCESS

The data have been submitted to the NCBI Gene Expression Omnibus (GEO) (http://www.ncbi.nlm.nih.gov/geo/) under accession No. GSE56893.

The authors would like to thank B. Jost, C. Keime and the members of the IGBMC (Strasbourg, France) sequencing platform for ChIP sequencing library preparation and Solexa sequencing J. Lachuer, F. Barbet and the members of the ProfileXpert sequencing platform (Lyon, France) for RNA-seq libraries sequencing and J. Moore (Fluidigm Corporation, South San Francisco, California 94080, USA) for technical help with DE genes RT-qPCR validation. We also would like to thank I. Masse for establishing RAR and RXR ChIP protocol and M. Paris, B. Boussau, O. Gandrillon, S. Gonin-Giraud, F. Flamant for critical reading of the manuscript and fruitful discussions. This work was performed using the computing facilities of the CC LBBE/PRABI.


Xenopatients 2.0

In the science-fiction thriller film Minority Report, a specialized police department called “PreCrime” apprehends criminals identified in advance based on foreknowledge provided by 3 genetically altered humans called “PreCogs”. We propose that Yamanaka stem cell technology can be similarly used to (epi)genetically reprogram tumor cells obtained directly from cancer patients and create self-evolving personalized translational platforms to foresee the evolutionary trajectory of individual tumors. This strategy yields a large stem cell population and captures the cancer genome of an affected individual, i.e., the PreCog-induced pluripotent stem (iPS) cancer cells, which are immediately available for experimental manipulation, including pharmacological screening for personalized “stemotoxic” cancer drugs. The PreCog-iPS cancer cells will re-differentiate upon orthotopic injection into the corresponding target tissues of immunodeficient mice (i.e., the PreCrime-iPS mouse avatars), and this in vivo model will run through specific cancer stages to directly explore their biological properties for drug screening, diagnosis, and personalized treatment in individual patients. The PreCog/PreCrime-iPS approach can perform sets of comparisons to directly observe changes in the cancer-iPS cell line vs. a normal iPS cell line derived from the same human genetic background. Genome editing of PreCog-iPS cells could create translational platforms to directly investigate the link between genomic expression changes and cellular malignization that is largely free from genetic and epigenetic noise and provide proof-of-principle evidence for cutting-edge 𠇌hromosome therapies” aimed against cancer aneuploidy. We might infer the epigenetic marks that correct the tumorigenic nature of the reprogrammed cancer cell population and normalize the malignant phenotype in vivo. Genetically engineered models of conditionally reprogrammable mice to transiently express the Yamanaka stemness factors following the activation of phenotypic copies of specific cancer diseases might crucially evaluate a “reprogramming cure” for cancer. A new era of xenopatients 2.0 generated via nuclear reprogramming of the epigenetic landscapes of patient-derived cancer genomes might revolutionize the current personalized translational platforms in cancer research.

In the Steven Spielberg’s 2002 neo-noir science-fiction thriller film Minority Report, a specialized police department called PreCrime apprehends criminals based on foreknowledge provided by 3 genetically altered humans called PreCogs. The 3 PreCogs have a vision, and the names of the victim and perpetrator, video imagery of the crime, and the exact time of occurrence are provided to the elite law enforcing squad, PreCrime, who are dispatched to arrest the predicted killer and prevent the crime. The system is successful, with no murders occurring in the city after the system is inaugurated. If we could similarly engineer state-of-the-art tools to forecast the appearance of biological properties and cellular features that are not apparent in clinically detectable stages, we could use cancer samples that are isolated for the assessment of prognostic and predictive biomarkers to see into the future of individual tumors to molecularly anticipate and therapeutically prevent their undesirable killing activity. The Minority Report’s PreCog-like software to predict crimes is being tested, and the 3D screens imagined in that fictional world have become a reality. Unfortunately, our current ability to foresee the evolutionary trajectory of any individual cancer remains in its infancy.

We propose that the commonly forgotten appreciation of Bond et al. 1 over a decade ago that �ifferentiation accompanying malignant progression in cancer may play a causal rather than a passive role in the critical tumor-behavior-switch from well-differentiated to highly aggressive form” must be revisited in light of the 2012 Nobel Prize Yamanaka’s induced pluripotent stem (iPS) cell technology, 2 , 3 which provided the missing evidence that most, if not all, somatic mammalian cells possess dedifferentiation potential. Reprogramming cancer cells obtained directly from primary tumors in individual patients can create live-cell developmental windows that could operate as new, self-evolving personalized models of cancer disease. Personalized translational platforms to foresee the evolutionary trajectory of individual tumors can be generated using in vitro-generated PreCog-iPS cells directly reprogrammed from patient-derived tumor cells and their in vivo PreCrime-mouse avatar derivatives obtained in immunodeficient mice following orthotopic injection of PreCog-iPS at the same location where the primary tumor was formed.

Understanding cancer as a disease of reprogramming and differentiation

Two predominant models have emerged to explain phenotypic and functional heterogeneity in human tumors. 4 The so-called “stochastic” or 𠇌lonal evolution” model is based on classic theories of the selection of mutants that are fit to survive in particular environments. Stochastic mutations in an appropriate cell type are selected if the cells possess a survival or proliferative advantage. This selected cell subsequently grows, and succeeding mutations in descendants yield a tumor with numerous mutations. However, only some of the mutations are selected for the advantages they provide (𠇍rivers”) the other mutations are “passengers”. Tumor heterogeneity in this model depends on the constellation of mutations and the phenotypes they generate accordingly, deep sequencing analyses have revealed that different tumor types differ significantly in terms of their mutation load and the existence of multiple clones within each tumor mass. 5 - 7 A second model is largely based on the principles of stem cell biology. 8 - 10 Carcinogenesis involves the accumulation of numerous mutagenic events over long time periods, but only normal stem cells with innate self-renewal capacity might remain in the tissue for a sufficiently long time to accumulate the oncogenic alterations that are necessary to support a complete transformation. Adult stem cells may represent the cells of origin in tumors that originate from tissues with high epithelial turnover, because they can be directly targeted with cancer stem cell (CSC) initiation events (i.e., CSCs directly arise from the malignant transformation of adult stem cells). More committed progenitors may acquire mutations and/or epigenetic changes that confer the ectopic capacity for perpetual self-renewal of CSCs. All cancer cells within a tumor arise from special self-renewing CSCs in this traditional view of one-way CSC hierarchy, and, consequently, cellular heterogeneity results from a CSC undergoing aberrant differentiation to form the pathologically recognized disorganized mass. Tumors are an aberration of the stem cell-driven mechanisms that govern the normal development of the corresponding tissue. Some tumors contain mixtures of very immature-appearing cells mixed with more differentiated cells with a subpopulation of cells bearing the so-called 𠇌SC markers” that can regenerate whole tumors in xenografts (i.e., tumor-initiating cells) with the cellular heterogeneity of the original mass. 8 - 13

CSCs obviously exhibit stem cell-like properties, but these cells do not necessarily originate from the direct transformation of normal tissue stem cells or progenitor cells. CSCs are also made and not just born individual tumors generally harbor multiple phenotypically or genetically distinct CSCs, because differentiated normal or non-stem cell tumor cells gain CSC cellular properties via the activation of partially known paths to stemness. 14 - 23 Critically, “stemness” is an emergent dynamicl state rather than the direct consequence of the activity of a particular stemness gene or a set of stemness genes. The CSC cellular state continuously evolves, and it can be switched on or off in response to cell-intrinsic or microenvironmental cues, including therapeutics. Moreover, a subset of CSCs may be exclusively responsible for metastatic spread, which is the final step in 90% of all fatal solid tumors. If an initial genetic defect in multi-potent stem cells is not the sole mechanism for the generation of dynamically evolving CSC reservoirs, then primary CSCs are not necessarily identical to metastatic CSCs. In this scenario, a more accurate description of the complex events that occur during tumor progression requires the incorporation of the potential for �llular reprogramming” with the stochastic and CSC models. 24 - 30 Cancer, cellular plasticity, and cell fate reprogramming are highly intertwined processes considering that not all cancer cells possess the necessary ability to permit their reprogramming to CSC �llular states”, and only some cancer genes (e.g., reprogramming stemness factors) possess the required capacity to fully elicit the reprogramming process in the right spatiotemporal context. This novel composite model of stem cell state acquisition envisions cancer as a disease that primarily involves cellular differentiation, and in which the many driving forces of the tumorigenic process, including the loss of pivotal tumor suppressors, such as aberrant transcription factors, signaling cascades, or epigenetic regulators, play a permissive role in tumoral progression by alleviating the developmentally unfavorable process of gaining tumor-initiating and/or metastasis-initiating capabilities. The commonly observed p53 functional inactivation, which is particularly concentrated in tumors exhibiting plasticity and a loss of differentiation characteristics, is generally attributed to survival benefits due to reduced apoptotic cell death, cell cycle arrest, and augmented opportunities for cancer cell evolution afforded by genomic instability. However, ever-growing evidence supports the hypothesis that p53 inactivation may destabilize the differentiated state and enable reversion to a more stem-like cellular state in the presence of appropriate oncogenic lesions. 20 , 31 - 34

If cancer is viewed as a disease of reprogramming and differentiation, cells with stem-like properties could be generated at any time during cancer progression so long as tumor suppressors, such as p53 (or other factors with the p53 function), are hindered, and appropriate oncogenic lesions that can enable epigenetic reprogramming to a stem-like cellular state are present. The plasticity potential of non-CSCs to acquire a CSC cellular state depending on their (epi)genetic state and/or interpretation of the microenvironmental in the absence or presence of stress (e.g., hypoxia, glucose deprivation, and chemotherapy) is not contemplated in the conventional depiction of the stem/progenitor cell hierarchy within a normal tissue being transformed into a similar one-way CSC hierarchy, and this concept is changing our current perception of CSC biology ( Fig.ਁ ). Tumorigenesis can be initiated and maintained by stem cell reprogramming, which is a molecular process by which cancer genetic alterations reset the epigenetic and transcriptional status of an initially healthy cell (i.e., the cancer cell of origin) and establish a newly acquired, pathological differentiation program of aberrant stemness that ultimately leads to cancer development. In addition, differentiated cancer cells may dynamically alter their transcriptional and epigenetic circuits to rewire into stem-like cells and refuel cancer growth by activating specific transcription factor drivers and modulating some collaborating chromatin regulators. These dynamic bidirectional transitions could provide a unifying view of cellular organization within tumors, because the same network of key regulators that contribute to transformation and cell state transitions to establish an epigenetic hierarchy within rare CSC populations give rise to a more differentiated cellular progeny (i.e., oncogenic reprogramming) that may also act within the established tumor to redirect differentiated tumor cells toward a less differentiated and stem-like cellular state and establish a dynamic equilibrium between reprogramming and differentiation. 30 Multiple independently derived and molecularly distinct stem-like clones could evolve depending on the likelihood of reprogramming within tumors. Some genetically and epigenetically unstable pools of CSCs might initiate or continue their clonal growth depending on the level and nature of oncogenic stimuli and in response to dissimilar local microenvironments. Other CSCs might remain dormant until appropriate signals are received, such as aberrant microenvironments created within tumors, which might influence the type of CSCs that arise from related but genetically distinct and independently propagating cancer cell clones. This complex scenario might explain the appearance of multiple clonal lineages within tumors that have been identified using single-cell sequencing. 7 The resulting heterogeneity may manifest as diverse CSC states that vary in terms of their proliferative, biomarker, and chemosensitivity profiles. 35

Figureਁ. Cancer is a disease of reprogramming and differentiation. Recent findings from multiple laboratories haven shown that normal cells and the bulk population of tumor cells that display low self-renewal capacity and a higher probability of terminal differentiation have the capacity to dedifferentiate and acquire a cancer stem-like (self-renewing, multipotent, high tumor propagating, and chemo/radio-resistant) cellular state in response to either genetic manipulation or environmental cues. Normal cells and differentiated cancer cells can acquire stem-like cellular states by several inducers of dedifferentiation mechanisms, including transcriptional networks involving key transcription factors (e.g., Oct4, Sox2, Nanog), miRNAs (e.g., let-7, miR-200 family), microenvironmental signals (e.g., hypoxia, inflammation, autocrine/paracrine oncogenic signaling pathways), epigenetic modifications (e.g., DNA demethylation, histone acetylation/methylation), and metabolic reprogramming. These findings from a diverse array of experimental models, along with correlative clinical data, strongly support that cancer stemness is an emergent dynamical state rather than the direct consequence of the activity of a particular stemness gene or a set of stemness genes in cancer tissues. The so-called CSCs should be viewed as multiple evolutionary selected cancer cells with the most competitive properties at some time (e.g., immortality, dormancy, chemo- or radio-resistance, motility, etc.) reversibly maintained by (epi)genetic mechanisms that result from a stochastic rather than a deterministic process. 89 - 92

Remarkably, the reprogramming-differentiation model of cancer formation and evolution explains many of the apparently paradoxical aspects of tumor biology: (1) the difficulty in the reconciliation of the rarity (of CSC numbers) with robustness (of CSC properties) to some tumors (2) the difficulty in the application of hierarchical models to some tumors, such as metastatic melanoma, which is one of the most aggressive, treatment-resistant human carcinomas that does not follow the CSC hierarchy 36 and likely represents an extreme example in which certain genetic make-ups allow for easy conversion between non-CSC and CSC states to endow almost the entire tumor cell population with CSC qualities (3) the lack of CSC markers that enable the general identification of stemness in a given tumor and the enormous plasticity of numerous putative CSCs 37 - 39 indeed, a common molecular genetic program for CSCs has remained largely elusive even within the same type of carcinoma, and fewer chromosomal aberrations are observed in disseminated CSCs, which occur at earlier stages of tumor development than previously thought and (4) the occurrence of unique stem-like states due to the continuous evolution and adaptation to new constraints, such as microenvironmental stresses or therapeutics, which might explain the ability of some tumor cells to transdifferentiate into functional vascular𠄾ndothelial cells that resist antiangiogenic therapy, 40 exhibit remarkable plasticity in chemoresistance (i.e., individual cells can transiently assume a reversibly drug-tolerant state to protect the population from eradication due to potentially lethal exposures), 41 and migrate and metastasize in response to dynamic interactions among epithelial, self-renewal, and mesenchymal gene programs that determine the plasticity of epithelial CSCs. Molecular heterogeneity and stochasticity of gene expression may drive a continuum of cancer cell states co-expressing stem cells and lineage-specific genes to encourage a greater likelihood of entering a CSC-like state, which may counterintuitively occur in response to the equilibrium between differentiation potentials. 42 - 44

Yamanaka stem cell technology for the recovery or foreseeing the evolutionary trajectory of individual cancers

PreCog-iPS cells and PreCrime-mouse avatars

A key corollary of the above-mentioned model of reprogramming𠄽ifferentiation during cancer formation and evolution is that differentiated somatic (non-cancerous and cancerous) cells are sufficiently plastic to aberrantly reprogram and acquire CSC properties. Therefore, tumor-associated reprogramming might be sufficient to generate aberrant but robust stem-like cellular states. Bond et al. pioneeringly suggested that the apparent �ifferentiation” accompanying malignant progression played a causal rather than passive role in tumor behavior. 1 However, since then, most cancer researchers have adopted an alternative view, in which tumors adhere to essentially irreversible hierarchies of cellular differentiation in parallel to normal tissues. Moreover, there is little compelling experimental evidence to directly support the potential for cellular dedifferentiation in mammalian cells. However, Takahashi and Yamanaka demonstrated that the forced expression of 4 transcription factors, namely, Oct4, Sox2, Klf4, and c-Myc, induced mouse fibroblasts to adopt pluripotent cell fates that resembled stem cells. 2 , 3 These and subsequent studies demonstrated that virtually all cell types can generate induced pluripotent stem (iPS) cells when the appropriate reprogramming gene sets are used, which supports the hypothesis that most, if not all, somatic mammalian cells possess dedifferentiation potential and confirms the inherent reversibility of the steps of cellular differentiation. The fact that several reprogramming transcription factors represent bona fide oncogenes, whereas many genes that act as barriers to nuclear reprogramming correspond to known tumor suppressors (e.g., p53), 45 - 50 strongly suggests that the necessary epigenetic rewiring for cellular reprogramming may be partially recapitulated during cellular transformation. Accordingly, the use of an iPS cell expression signature comprised of genes that are consistently upregulated in independent studies with iPS cultures has revealed significant similarities between p53-mutated cancers and cells that have undergone intentional reprogramming in vivo. 51 - 55 The frequency of reprogramming appeared to be extremely low the occurrence of cellular barriers against induced reprogramming supports the feasibility of resetting the epigenetic architecture of any differentiated cell to resemble a stem cell, perhaps not perfectly, because the tumor-associated reprogramming of p53-deficient, oncogene-expressing cells might generate aberrant stem-like cellular states that phenocopy fetal stem cells or iPS cells.

CSCs are unlikely to arise by the “invention” of completely novel biology in a molecular scenario in which cellular reprogramming is a natural, highly plastic phenomenon that allows stemness to emerge and diversify in the tumorigenic context. Therefore, the mechanisms of CSC generation and evolution are not fully amenable to analysis using commonly employed patient samples, because these tumors can only be studied after the transformation events have occurred. Moreover, reversible and transient modifications, rather than the accumulation of irreversible and stable modifications, primarily regulate the key events that govern the acquisition of CSC-like cellular states. The appearance of biological properties and cellular features are not apparent in clinically detectable tumors, and the cancer samples that are isolated for routine assessment of prognostic and predictive biomarkers impose significant challenges. The disaggregation of the tumor mass for analyses may obscure the initially present local heterogeneity, and the genesis of stem-like cancer cell states likely reflects the corruption of a reactivated normal stem cell repertoire. We are compelled to investigate the spectrum of both normal and neoplastic stem cell states in the development of new strategies that target plasticity and the reprogramming of cancer cells rather than selected markers in CSC-like cells. But, can we manipulate the reprogramming events within tumor tissues to create self-evolving developmental windows of cancer disease and recover past events in fast-growing types of human tumors? Can patient-derived cancer cells be genetically engineered in a manner that can inform us beforehand about the future of individual tumors to molecularly anticipate and therapeutically prevent their undesirable killing activity, as in Minority Report?

Translational research with patient-derived cells and orthotopic models is the newest approach for closer-to-bedside translational cancer research. The establishment and characterization of serially transplantable, orthotopic, subject-derived tumor grafts that retain crucial characteristics of the original primary tumor specimen and efficiently reproduce drug-resistance and/or dissemination patterns that are characteristic of specific tumors at diagnosis are useful resources for the selection of more appropriate treatment regimens and the development of new drug therapies and novel therapeutic applications for currently approved drugs. 56 - 64 The assessment of therapy responses in patient-derived orthotopic tumor models that maintain the morphologic, histologic, and genetic characteristics of patient tumors, including the behavior of the stromal component and tissue architecture, would improve preclinical drug translation to patients. However, efficiency, speed, and cost limit the use of this type of in vivo mouse avatar-based diagnostic model. The development process requires large amounts of fresh tumor material and intensive resources to generate the tumor graft. Even in the best conditions, 25�% of implants fail, and those that engraft require 6𠄸 mo of additional propagation to be useful for treatment. The limitations of this approach certainly challenge the broad clinical application of the process, but some promising response data suggest that these “mouse avatars” are an interesting research tool that may become useful when combined with the genomic revolution. However, the massive resources devoted to genome sequencing of human tumors have produced important data sets for the cancer biology community, but little new biology has been revealed. 65 Next-generation sequencing (NGS) of patient tumors before and after chemotherapy coupled with the patient tumor cells growth in mice to test the NGS technique-driven predictions might further complicate any attempt to translate bulk genetic data into therapeutic treatment options in a simple, straightforward manner. Pharmacogenomic studies, such as the breast cancer genome guided therapy study (BEAUTY Project), in which researchers obtain 3 whole-genome sequences (one from the patient’s healthy cells before treatment, one tumor genome before chemotherapy, and one tumor genome after chemotherapy) and pair patients with mouse avatars to identify the best individual treatment, will clarify whether chemotherapy can be tailored to cancer patients based on their individual and tumor genomes. Therefore, this technique combination should advance our understanding of cancer biology, because the recapitulation of entire tumor heterogeneity in patient-derived cells allows for organ-specific drug sensitivity evaluation and mechanistic explanations of chemo-resistance. True proof-of-concept will come from drug candidates that are efficacious in patient-derived cell xenograft models, which are easily translated into clinical applications. The primary patient-derived tumor model is promising for genome-wide personalized drug discovery and a more rational-driven modeling of clinical trials, but time- and resource-consuming mouse avatar translational platforms will be limited to cutting-edge research laboratories. We propose that the Yamanaka stem cell technology can be used to (epi)genetically reprogram primary cancer cells obtained directly from individual patients to create self-evolving developmental windows of cancer disease.

PreCog-iPS cancer cells

Generation and utilities

We hypothesize that the nuclear reprogramming of patient-derived tumor cells can yield a large CSC-like population, i.e., PreCog-iPS cancer cells, which could theoretically be propagated indefinitely in a pluripotent state or near-pluripotent state. In an oversimplified, hypothetical approach, cancer samples will be obtained immediately after resection, and histologically normal tissues at specimen margins will be used as controls ( Fig.ਂ ). Epithelial cells will be isolated, and cancer and normal margin cells will be infected with viruses encoding the Yamanaka stemness factors. Genomic DNA will be isolated from the specimen margin and cancer epithelial cells that were cultured separately. PreCog-iPS cancer cells that have captured the genome of an affected individual could be generated using the reprogramming of tumoral epithelial cells and the apparently normal, isogenic cells beyond the tumor margins. These cells will be immediately available for experimental manipulation, including the preparation of cancer vaccines, pharmacological screenings aimed to discover antibodies against pluripotent cancer cells, and the exploration of their developmental potential. For example, a high-throughput screen to identify cytotoxic inhibitors of PreCog-iPS cancer cells may be established. The development and optimization of a protocol that will enable the culture of undifferentiated PreCog-iPS cancer cells in a high-content, multiwell plate will allow for the automatic application of multiple (known or experimental) anti-cancer compounds and the accurate assessment of cell viability after short-term (e.g., 24 h) exposure. Pluripotent-specific inhibitors could be identified at the individual patient level. We could screen the selective cytotoxicity of identified drugs in multiple concentrations against differentiated cells that are genetically matched to the undifferentiated cells in the previous screen to obtain reliable sensitivity values. We can also screen the original patient-derived tumor cells from which the iPS cancer cell lines were derived to generate reliable sensitivity values for the PreCog-iPS and their cancer cells of origin. The setting of very stringent thresholds (e.g., 㺀% inhibition in PreCog-iPS cancer cells but less than 20% inhibition in other types of differentiated cancer cells at the same high concentration of a given compound) might finally identify pluripotent-specific cancer (PluriSCan) drugs, i.e., bona fide “stemotoxic” cancer drugs. 66 PreCog-iPS cancer cells should lose their sensitivity to PluriSCan-stemotoxic drugs upon differentiation, and patient-derived cancer cells should acquire this sensitivity upon their reprogramming to iPS cells. The short exposure duration of the PluriSCan-stemotoxic drugs in this screen (24 h) and the stringent threshold for “hit” identification (㺀% reduction in number of viable cells) will identify cytotoxic compounds that actively eliminate pluripotent cancer cells rather than proliferation inhibitors. We can verify the pluripotent-specific effect of PluriSCan-stemotoxic drugs by utilizing genetic labeling systems for the expression of pluripotent hallmark genes (e.g., red labeling) vs. early markers of differentiation (e.g., green labeling), because these agents will specifically eliminate undifferentiated (red) cells without a detectable effect on the (green) differentiated population. The application of toxicogenomic approaches to identify gene expression alterations after exposure of the PreCog-iPS cancer cells to the PluriSCan-stemotoxic drugs might provide a functional annotation of deregulated genes and identify key pathways that are causally perturbed by the cytotoxic effects of PluriSCan-stemotoxic drugs. A battery of unknown compounds with putative anti-cancer activity may be tested by applying the gene expression data to the connectivity map (cmap), which is a database of genome-wide transcriptional expression data generated from cultured human cells treated with bioactive small molecules. This process can facilitate the discovery of pathways that are perturbed by small molecules of unknown activity based on the common gene expression changes that similar small molecules confer. Importantly, the screening and discovery of “hits” might be extremely valuable in the search for personalized drug candidates with anti-CSC activity, even if patient-derived PreCog-iPS cancer cells reach a near-pluripotent state that rapidly derives in exacerbated and imbalanced early cancer cell differentiation.

Figureਂ. Nuclear reprogramming of patient-derived cancer cells: Generation and utilities. Schematic drawing depicting the generation and utilities of patient-derived PreCog-iPS cancer cells and PreCrime-iPS orthotopic tumors.

The emergence of genome-editing technology over the past few years has made it feasible to generate and investigate human cellular disease models with greater speed and efficiency. The extent to which patient-derived iPS cancer cells will offer any advantage in our understanding of the disease process might appear unclear for a disease that is driven by numerous genetic and environmental factors, such as cancer. We should acknowledge that the most rigorous possible comparisons would occur between cell lines that differ only in disease mutations, i.e., otherwise isogenic cell lines. The correction of specific genetic alterations into the genomes of PreCog-iPS cancer cells would allow investigators to directly connect genotype to phenotype and establish causality (e.g., functional studies to validate new cancer gene candidates) in a pluripotent cancer background and during self-evolving differentiated states. The results can compare relevant phenotypes (e.g., sensitivity to molecularly targeted drugs) and largely minimize confounders to draw more scientifically rigorous conclusions. Any off-targets that are produced by genome-editing tools might make it unrealistic to expect 100% isogenic parental and targeted cell lines in any given experiment. However, this factor does not undermine the fact that the genomic engineering of iPS cells derived from patient-derived cancer cells and isogenic iPS cells derived from apparently normal, isogenic cells beyond the tumor margins may become a proof-of-principle strategy and provide unforeseen insight into the stemness-driven pathophysiology of cancer diseases. The most robust possible proof-of-concept study design would be the insertion of well-known mutations that are commonly overrepresented in some cancer tissues (e.g., KRAS in pancreas and colon cancer, EGFR in lung carcinoma) or new cancer gene driver candidates into an iPS cell line that is reprogrammed from either unsorted or specific subpopulations (e.g., adult stem cells) in the normal tissue adjacent to cancer tissue. This method would test the sufficiency of the mutation for disease, the necessity of the mutation for the disease behavior, and/or the response to molecularly targeted drugs, and correct key disease mutations in a cancer patient-specific iPS cell line. Currently existing genomic-editing tools in human pluripotent stem cells, e.g., zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and clustered regularly interspaced shored palindromic repeats (CRISPRs)/CRISPR-associated (Cas) systems, 67 - 71 could perform proof-of-principle exercises to unambiguously elucidate the necessity and sufficiency of given mutations for given cancer disease phenotypes. This approach might be extremely valuable to assess the importance of genetic modifiers on cancer disease penetrance, i.e., whether a cancer mutation evokes a diseases phenotype in some cell lines but not in others. It might be particularly informative to start with a BRCA1-mutated breast cancer patient-specific iPS cell line and use genome editing to 𠇌ure” the BRCA1 disease mutation.

The 𠇌orrection” of the malignant phenotype in culture using PreCog-iPS cells in the short-term might significantly accelerate the study of cell pathology and disease modeling and facilitate translational research into therapeutics. Genome-editing tools should create a straightforward approach to insert reporters into cancer genomic loci of interest to allow for RNA-interference or small-molecule screens to identify genes and probes that provide the desired functional effect. The use of genome editing in the long-term may create 𠇌hromosome therapies” that utilize epigenetic strategies to regulate chromosomes, because PreCog-iPS cancer cells will harbor the corresponding aberrant karyotype or the initial patient-derived tumor population. Tumor cells frequently display an abnormal number of chromosomes, a phenomenon known as aneuploidy, and non-cancerous aneuploidy generates abnormal phenotypes in all species tested (e.g., trisomy 21 generates Down syndrome). Cancer-specific aneuploidies generate complex, malignant phenotypes through abnormal doses of the thousands of genes. Aneuploidy may partially explain 2 CSC-related cell properties, such as immortality, because cancers survive negative mutations and cytotoxic drugs via resistant subspecies through their cellular heterogeneity, and non-selective phenotypes, such as metastasis, because of linkage with selective phenotypes on the same chromosomes. 72 - 78 The structural chromosome rearrangements have received considerable attention, but the role of whole-chromosome aneuploidy in cancer is less understood. This discussion has overshadowed efforts to address a related but no less important question: can aneuploidy be targeted for cancer therapy? Jiang et al. 79 recently reported that the insertion of a large, inducible X-inactivation (XIST) transgene into the DYRK1A locus on chromosome 21 in Down syndrome pluripotent stem cells using ZFNs de facto corrected gene imbalance across an extra chromosome. Genome-editing tools that correct the aneuploidy karyotype might become the cancer therapies, because these tools may be effective against a vast array of aneuploidy tumors without previous knowledge of the underlying mutations or the deregulated pathways.

PreCrime-iPS mouse avatars

Generation and utilities

PreCog-iPS cells might be valuable in the design of new approaches for cancer disease modeling, because the procedures leading to their generation can be repeated in a highly controlled manner to generate large numbers of cells for in vitro and in vivo studies. Moreover, the reversal of patient-derived cancer cells from a given evolutionary stage via reprogramming with Yamanaka stemness factors should allow for redifferentiation in orthotopic injection assays in the target tissues of immunodeficient mice, i.e., the PreCrime-iPS mouse avatars. A subset of these cells would undergo several developmental stages of human cancer ( Fig.ਂ ). The PreCrime-iPS avatar mice model should cycle through specific stages of human cancer diseases, as opposed to the examination of cancer progression characteristics in an animal model and the assessment of human applicability. First, the reprogramming of cancer cells from recurrent, late-stage human carcinomas to a pluripotent state should create the reappearance of cellular features and molecular markers of the early and intermediate stages of that particular cancer that are no longer evident in the terminal stages from which the PreCog/PreCrime-iPS models originated. The recapitulation of early stages of biologically aggressive types of human carcinomas (e.g., pancreatic cancer, glioblastoma, ovarian cancer, and lung cancer) creates unexplored cancer developmental windows that may allow for a direct exploration of their biological properties for drug screening, diagnosis, and personalized treatment. Comparisons with the original tumor of the individual patient to short-term histological and genomic profiles can inform us about the ability of PreCrime-iPS cells to differentiate into lesions associated with earlier stages of the advanced disease. Similarly, long-term histological and genomic profiles can inform us about the ability of early stage PreCrime-iPS cells to differentiate into lesions that succeeded as invasive stages of the disease in vivo. These profiles provide a complete recapitulation of the carcinogenesis process that is fully driven by the genome of an affected individual and captured during the process of PreCog-iPS cell generation.

It might be intriguing to investigate whether we might expect the appearance of cellular features and molecular markers in the earliest, precursor stages of that particular cancer (e.g., hyperplastic enlarged lobular units in breast cancer) upon the reprogramming of cancer cells from early or even pre-invasive cancer stages (e.g., ductal carcinoma in situ lesions in breast cancer) to a pluripotent state. Regardless of the orthotopically injected PreCog-iPS cell fate, we can generate a system in which cancer structures that occur within PreCrime-iPS tumors may be studied as live, ex vivo, or in vitro models of the precursor, early, invasive, and metastatic stages of individual tumors at the patient level. We might harvest tissues from PreCrime-iPS tumors with contralateral control tissue at different intervals after injection to establish the conditions under which the tissues will be cultured in vitro. We can use this “organoid system” to rapidly identify biomarkers and pathways that could permit early detection or facilitate disease monitoring after therapy. For example, we could examine the proteins that are specifically secreted or released from explants of PreCrime-iPS tumors by comparison with proteins that are secreted or released from explants of contralateral control tissue from the parental PreCog-iPS cell line cultured in the undifferentiated state. Bioinformatics approaches can be used to discover previously unappreciated networks and biomarkers associated with very early- (even pre-cancerous), early-to-invasive-, or metastatic-stage pathology by combining data from an iPS-driven �ncer xenopatient 2.0” mouse model of the disease and currently available databases of human clinical samples.

If the pluripotency epigenetic environment can dominate over certain oncogenic states, an accurate decodification of the molecular barriers that prevent the cancer (differentiated) phenotype from being reversed to a pluripotent/near-pluripotent (stem) status might inform us of the key mechanisms that govern how differentiated cancer cells dynamically enter into stem-like cellular states. Specifically, if reprogramming of patient-derived tumor cells leads to a loss of tumorigenicity, then it might be possible to normalize in vivo the malignant phenotype by inferring the epigenetic marks that have corrected the malignant effects of oncogene activation and oncosuppressor gene inactivation in the reprogrammed cancer cell population. Different experimental results suggest that cancer cells can be reprogrammed to a non-tumoral fate that loses their malignancy. Miyoshi et al. 80 reported that defined factors induced reprogramming of gastrointestinal cancer cells to demonstrate slow proliferation, sensitization to differentiation-inducing treatment, and reduced in vivo tumorigenesis in NOD/SCID mice. However, these authors reported only xenograft formation with no histology or immunohistochemistry. Zhang et al. 81 recently demonstrated that the reprogramming of sarcoma cells using the 4 canonical Yamanaka genes plus Nanog and Lin28 created cancer cells that lost their tumorigenicity, exhibited reduced drug resistance, and dedifferentiated as iPS cells into various lineages, such as fibroblasts and hematopoietic lineages. Interestingly, the expression of endogenous c-Myc appeared to be reduced in their cellular model, and it was hypermethylated during the reprogramming process. These findings support the notion that the epigenetic modification of a cancer cell via nuclear reprogramming could correct some malignant effects of oncogene activation and oncosuppressor gene inactivation, which may constitute the basis for a novel strategy to control tumor progression. 81 , 82 Zhang et al. 81 reported the terminal differentiation and loss of tumorigenicity of human sarcomas via pluripotency-based reprogramming, but these authors failed to observe benign mature tissue elements in their teratomas assays. Kim et al., 83 the only group that has reported the successful generation of a patient-derived iPS cell line from human pancreatic ductal adenocarcinoma (PDAC), only obtained one iPS-like line from a pancreatic cancer harboring a KRAS mutation, the predominant driver of PDAC, and a deletion in exon 2 of the pivotal tumor suppressor CDKN2A. Biological barriers, such as cancer-specific genetic mutations, epigenetic remodeling, accumulation of DNA damage, or reprogramming-induced cellular senescence, may influence the reprogramming of human primary cancer cells. 84 Therefore, further work will determine the types of mutations that predict whether a cancer cell can be reprogrammed to pluripotency. Conversely, genetically engineered models of conditionally reprogrammable mice that transiently express the Yamanaka stemness factors 85 sequentially to the activation of phenotypic copies of specific cancer diseases (e.g., in transgenic mice of BRCA1 deficiency or HER2 overexpression or in chemically induced mouse models of human carcinomas) might inform us about the feasibility of the “reprogramming cure” of cancer as an revolutionary alternative to the present therapeutic approaches.

As mentioned above, PreCrime-iPS cells from individual tumors are expected to have the capacity to progress through the early or even pre-cancerous developmental stages of one individual cancer. This approach would provide a unique opportunity for the discovery of intrinsic processes and the secreted biomarkers (e.g., proteins, metabolites) of live, early-stage human cancer cells and particularly the biologically aggressive types of human carcinomas. However, CSC cellular states may already be programmed in pre-malignant cancer lesions, and these tumor-initiating cells could determine the later phenotype of the invasive lesion. Therefore, PreCrime-iPS cancer cells would develop cancer stages ahead of the original stage, from which PreCog-iPS cells were engineered, i.e., bona fide self-evolving in vivo models that can inform us beforehand about the future of individual tumors. A schematic overview integrating the key concepts underlying the relevance of the �ncer xenopatients 2.0” based on the generation and study of PreCog/PreCrime-iPS cancer cells is provided in Figureਃ . The hypothetical Waddington epigenetic landscape structure displayed in Figureਃ schematically integrates the concepts behind the hierarchy of cancer cell type diversification during cancer development as a disease or reprogramming and differentiation. 86 - 88 The horizontal axis is a schematic projected state space coordinate, and the elevation (quasi-potential) represents the relative instability of individual cancer cellular states at each space location. The balls represent each type of cancer cell, defined by a particular position in the state space. Each cancer cell type in the tumor corresponds to one of the high-dimensional attractors that a large network of hundreds to thousands of genes can produce in a cancer tissue. Attractors of regulatory networks exhibit the natural properties of distinct cancer cellular states (i.e., cancer cell types), because they are discretely distinct entities and self-stabilizing (i.e., robust to small perturbations but permissive to 𠇊ll-or-nothing” transitions to other attractors given sufficiency high perturbations). The attractors behave as the lowest points in “potential wells” or valleys, which are separated by “hill tops” that correspond to unstable states and represent the bona fide epigenetic barriers in the patient-derived cancer genome landscape. However, the elevation in the quasi-potential energy landscape does not constitute a true “potential energy” in the classical sense, but rather helps conceptualize the global dynamics of non-equilibrium systems (such as gene regulatory networks) by providing information on the “relative weights” of the various valleys. Therefore, it accurately affords the intuition of a type of gravity that would drive the stability-seeking movement of a given cancer cell state 𠇍ownward”.

Figureਃ. Xenopatients 2.0: The key principles of reprogramming patient-derived cancer genomes as viewed within the analogy of Waddington’s landscape. The hypothetical epigenetic landscape depicted in (A) illustrates the concepts behind the hierarchy of cell type diversification during development and it can also be used to illustrate the principles of the 𠇌rater-like” attractor state of pluripotent stem cells on top of walled plateaus and what might be expected from reprogramming patient-derived cancer genomes (B). The horizontal axis is a schematic, projected state space-coordinate the elevation (quasi-potential) represents the relative instability of individual states at each state space location. Each cell type, defined by a position in state space is represented by balls. The more “plastic” the cell, the higher up the hill it is. Hence, stem (S) pluripotent is at the top, multipotent further down, progenitor (P) below that, and differentiated (D) at the bottom. The hills and valleys represent the potential differentiative pathways available. A particular basin may be approached from more than one pathway. Taking the detour via the pluripotent PreCrime-iPS (“jumping back to the summit”), we ensure the occurrence of a robust “ground state” that is self-maintaining in culture conditions favorable to the stem cell state but nevertheless globally situated at a “high altitude”, which affords the PreCrime-iPS state a strong urge to spontaneously and stochastically differentiate away and occupy all other attractors situated at a lower 𠇊ltitude” without the need of an “instructive” signal to exhibit the gene expression patterns owned by any specific type of cancer cells. In this scenario, in which the cancer genome landscape has 𠇍irection” (i.e., once the �ll” has committed to its descent, it cannot roll back up of its own accord it is expected that there is no requirement to retrace developmental pathways intrinsically captured in the patient-derived cancer) (i.e., the fundamental positioning of the cancer cellular states relative to the terrain of differentiation would be intrinsically determined by the gene regulatory networks pre-existing in the tumor due to the self-stabilizing and memory properties of attractors) once the signals activated in the orthotopic site will flatten the “pluripotency crater” and allow cells to move down the landscape. Cancer cells will differentiate by traveling down the crevasses between the valleys, sometimes starting down different trajectories from the beginning and other times sharing ambiguous fates at the top that get defined as they move along the pathway. Therefore, the Waddingtonian representation of induced pluripotency in patient-derived cancer genomes landscapes intuitively illustrates the notion that diverse cancer states can be early (E) recapitulated (�k in time” PreCrime-iPS1) and/or late (L) forecasted (𠇏orward in time” PreCrime-iPS2), as shown in the cuts through the levels corresponding to the lines in the lowest landscape. Cells are represented by balls, fates by colors.

The state space idea provides a conceptual framework that easily explains how cancer reprogramming should be viewed as transitions between attractors and simultaneously illuminates why the grafting of biologically aggressive cancer cells obtained from advanced cancer stages into immunodeficient mice as tumor fragments, dispersed cells, or cells sorted for CSC markers allows for an immediate regression to the late-stage phenotype and thus an undesirable spatiotemporal restriction to the rapidly growing, aggressive tumor stage from which the injected cells were derived. The inefficiency of cancer cells grafted into mice to generate a highly informative occurrence of stage-specific expression of the cancer genome can be explained in terms of the “ruggedness” of the attractor landscape. Heterogeneous cancer cell populations are expected to be dispersed and occupy multiple sub-attractors within an attractor with a “washboard” surface. In this scenario, the large number of these microstates within any cancer cell population notably disperses the response profiles in the absence of strong (re)programming perturbations. In other words, heterogeneous cancer cell populations that are largely refractory to differentiating signals (which would remove them from the attractor to occupy lower attractors of differentiated cells or destabilize the attractor to generate new patterns of differentiation) will rapidly repopulate the original epigenetic landscape of the primary tumor, because the global slope in the landscape also accounts for the time-of-development arrow. The isolation of extremely rare CSC-like populations based on the absence or presence of a few molecular markers may conversely enrich cellular states that sit on the separatrix (hilltops and crests) that separates the attractors (i.e., a delicate stationary state that is unstable and rapidly moves to either attractor in response to any slight perturbation) or near the rim of the attractor basin (i.e., a group of “outlier cells” that are primed to differentiate). This commonly used approach fails to reconcile rarity with the robustness of the CSC-like phenotype as defined by various arbitrary markers. In summary, the height of epigenetic barriers between the discrete cellular phenotypes, the state space distance between cell types, the ruggedness of landscape, and the heterogeneity of starting cancer cells notably impede the cancer genome of a particular individual to be expressed in a stage-specific fashion as opposed to undergoing an immediate regression to the late-stage phenotype from which the tumor cells are commonly derived in the classic mouse avatar approaches. A different scenario should emerge when activating a pre-existing coherent gene expression program by exogenously stimulating a transition into a �ntral attractor” that encodes such a program. We may be able to generate metastable attractors with a large, flat basin that is particularly wide in pluri-/multipotent cells and maintained by the gene circuit around Yamanaka stemness factors by taking the detour via the pluripotent iPS state, thus allowing for balanced but large fluctuations to “scan” the cancer state space and temporally approach the pattern of a prospective “lineage” of differentiated cancer cells. Due to its central location in the state space between the valleys that represent their prospective fates, stem cell attractors generated from individual tumors will naturally exhibit promiscuous gene expression and have access to the attractors of various cancer cell types. These stem cell-like attractors will be situated at a “high altitude” in the landscape, and these cellular states will afford a strong urge to 𠇏low down” the valleys and 𠇍ifferentiate away” by populating all other cancer cell attractors situated at a lower 𠇊ltitude”. The well-recognized tendency of iPS cell lines to preferentially differentiate into their lineages of origin should translate into the preference for PreCog/PreCrime-iPS cancer cells to regenerate the cancer type from which they were derived. PreCog-iPS cells may spontaneously and stochastically differentiate into all of the cell types comprised in the captured cancer genome without the need of an “instructive” signal to convey the gene expression patterns owned by particular cancer cell states, as occurs in multipotent progenitor cells or embryonic stem cells when they are placed in culture conditions unfavorable to the stem cell state. Upon re-establishing bona fide pluripotency by pushing patient-derived cancer cells toward a new fate in an “uphill battle”, iPS cells in PreCrime-mouse avatars may be able to “roll down” toward more possible outcomes than originally existed in the patient’s tumor, because the process of reprogramming implicates a restructuring of the epigenetic landscape and a stabilization of the transition states. Therefore, the successful generation of all cancer cell fate decisions in a given cancer genome landscape could not be achieved spontaneously on any reasonable time-scale using currently available mouse avatar strategies, because they should be accomplished through transitions between high-dimensional attractors. Nuclear reprogramming of patient-derived cancer cells can more rapidly identify walkable paths that connect existing or 𠇏uture” attractors, because it could create all of the pre-programmed attractor states that can possibly emerge from the gene regulatory networks contained in a given patient-derived cancer gene genome.

Corollary

Our current ability to recover or foresee the evolutionary trajectory of any individual cancer remains in its infancy. We have hypothesized that pluripotent or near-pluripotent stem cell lines generated from patient-derived cancer cells should have the capacity to progress through many, if not all, of the developmental stages of the cancer based on the recently recognized ability of cultured tumor cells to be reprogrammed to pluripotency by nuclear reprogramming. We can create self-evolving developmental windows of a captured cancer genome and recover past events in fast-growing types of human carcinomas by manipulating the naturally occurring reprogramming events within tumor tissues. Consequently, this live-cell progression approach will provide us with an unforeseen experimental setting in which early molecular markers for intrinsically aggressive tumors that rapidly evolve into aggressive, treatment-refractory cancer stages may be discovered. Reprogramming the epigenetic landscapes of patient-derived cancer genomes using the Yamanaka stemness factors should generate state-of-the-art cellular tools to reveal biological properties and molecular features that will not be evident in the advanced stage at which the tumor samples are generally obtained to assess diagnostic and prognostic parameters. Moreover, nuclear reprogramming of patient-derived cancer cells can generate 𠇏orthcoming landscapes” that can inform us beforehand about the future of individual tumors and the occurrence of unorthodox inter-cell developmental paths in tumor tissues. The proposed models could test potential therapies to block specific developmental stages of the disease. Therefore, a new era of mouse avatars (xenopatients) 2.0 might revolutionarily transform the currently available personalized translational platforms and significantly improve our tools for drug screening, diagnosis, and personalized treatment.


Initial coin offerings (ICOs) are driving most of the light and heat in the blockchain world these days. People are raising enormous sums in cryptocurrencies for ventures with somewhere between little plausibility and ordinary levels of startup plausibility. In many ways it looks a lot like the last years of the internet bubble way back when there are a lot of parallels. The flows of funding may be driven by some combination of people bypassing Chinese currency controls, early holders of Bitcoins and Ether diversifying their holdings within the blockchain ecosystem, and various large investment concerns whose owners have found they can make a quick buck by flipping blockchain tokens, all of which adds fuel to the fire. As I asked earlier this year, if fairly dubious ventures can pull in tens of millions of dollars doing this, why can't we use this to fund thoughtful, legitimate initiatives in rejuvenation research? The challenge here lies in finding a meaningful use for blockchains and network effects in our world of research and development.

Some groups are forging ahead with that effort. I've mentioned Open Longevity's ICO, in which they seek to fund collaborative human trials of various potential pharmaceutical means to slow aging, but for today the focus is on Youthereum Genetics, a newer venture that also seeks to use an ICO as a mechanism to fund research and development. The Youthereum principals are initially intending to work on a means to deliver pluripotency factors involved in the creation of induced pluripotent stem cells to spur regeneration. A demonstration of this was conducted by a research group and published earlier this year, resulting in health benefits for the progeroid mice often used in early stage aging research. This was somewhat surprising as an outcome: haphazardly inducing cells to become pluripotent in a living organism sounds like a rapid short-cut to cancer.

The next steps will be to try this in normal mice, quantify the most useful dose and delivery method, and continue to watch carefully for evidence of cancer as a side-effect. In the best case this may be a road to a regenerative therapy analogous to stem cell transplants, but that remains to be seen. As in so many areas of research where interesting results may or may not lie ahead, the first question is where the funding for that work will be found. The Youthereum team hope that tapping into the blockchain market is the way to go.

I recently had the chance to chat with Yuri Deigin of Youthereum Genetics, and to ask some questions about his aims. As you can tell he is proceeding from a programmed aging point of view - something that I tend to present as standing in diametric opposition to the more mainstream view of aging as accumulated damage. Possibly oversimplifying, this is the question of whether in aging epigenetic change (a program) causes damage, or whether damage causes epigenetic change (a reaction). A programmed aging point of view leads one to intervene in processes that are, to the accumulated damage point of view, secondary consequences only, and attacking secondary consequences just won't be very effective. We are close to the years in which one side or the other will be definitively proven correct, due to the implementation of specific approaches to the treatment of aging as a medical condition.

Nothing is completely black and white, however, and it is interesting to see the development of areas where theorists from either side of this divide will meet in the middle at approaches to therapies that both will consider potentially useful enough to try, but for different reasons. Some classes of stem cell therapies and efforts to achieve similar effects through changes in signaling or reprogramming cells in situ rather than through delivery of cells are a good example of the type. From a programmed aging point of view, these are levers with which to change epigenetic signaling to more youthful levels, while from an accumulated damage point of view, they could be essentially compensatory in nature, like stem cell therapies, but picking the slack to some degree for native regenerative processes that are hampered by damage.

Why Youthereum Genetics, and why now? Who are you, and how did this organization come to be?

I am a Russian-Canadian transhumanist longevity activist, amateur theoretical biologist, and a biotech entrepreneur. Previously, those areas of my life did not intersect, but in the past few months the stars have aligned to prompt me to finally combine my passion and expertise, and channel them into an undertaking I consider the most important in my life: curing aging. Or - getting off the high horse - at least developing some significant life extension therapies for humans, because at the moment there are none. By "significant" I mean something that can prolong our lives by at least 30%. No therapy outside of caloric restriction has been able to achieve this milestone even in mice - not rapamycin (26%), not metformin (14%), not telomerase (24%), not senolytics (26%) or any other 'geroprotector'. And caloric restriction which holds the record for non-genetic lifespan extension (up to 50% in various rodents) failed to produce anywhere near as spectacular a result in primates. In the two macaque studies conducted on CR, at most a 10% median lifespan increase was observed in females and in some groups CR actually shortened lifespan.

Personally, I believe that the reason behind this inability to put a significant dent in aging in the past 50+ years lies in its programmed nature. Over the years, I have seen plenty of evidence in support of this hypothesis with the most convincing being results from parabiosis and young plasma experiments. I think that aging is ultimately controlled by the hypothalamus, just like all other aspects of ontogenesis. This concept dates back to the 1950s and is described in detail in the works of Dilman, Frolkis and Everitt's. Recent research by Dongsheng Cai and his colleagues provides further evidence for the hypothalamic hypothesis. On the cellular level, aging is most likely both tracked by and executed via epigenetic regulation of gene expression. Several years ago it was first observed that a person's age is highly correlated to his/her epigenetic profile. Later it was recognized that these 'epigenetic clocks' are effective life expectancy predictors, which confirmed that epigenetics is a key component of the aging process. Many organisms were found to have such 'epigenetic clocks' that are highly correlated with both their age and probability of death.

Moreover, Nature knows how to roll back or even completely reset the epigenetic clock. This is done for every new embryo and is most likely the reason why every new animal is born young despite having started as an oocyte cell of the same age as its mother (as mother's oocytes were formed while she herself was still in utero). Finally, experiments with epigenetic rejuvenation which demonstrated that rolling back epigenetics rejuvenates not just individual cells but entire organisms (and prolongs their lifespan) have confirmed that epigenetics is not just a consequence but an important driver or aging. This is where Youthereum Genetics comes in. Based on the recent work of Juan Carlos Izpisua Belmonte's group at Salk, who have shown that periodic induction of OSKM transcription factors can prolong lifespans of progeric mice by up to 50%, we hypothesize that aging can be rolled back by periodic epigenetic rollbacks. Our strategy is aimed at translating this hypothesis into a safe therapy that produces sizable, noticeable rejuvenation in humans.

Why us and why now? In a nutshell, because I grew too tired of waiting for someone else to do it and not seeing anyone step up to the plate. So I put together a team that is capable of designing and overseeing experiments for all the steps involved in first verifying the science behind our hypothesis and then translating it into a therapy should science hold up. The only thing left to do now is a small matter of raising the necessary funding. I am being sarcastic, of course. It is a huge challenge, especially given the amounts required and the associated scientific risks involved. But I am willing to try, even in the face of high odds against.

What is your model for what is going on under the hood in animals transfected with pluripotency factors? Why does it produce benefits?

As I mentioned, I am of the Programmed Aging Witnesses cult. At least that's what some opponents of programmed aging call us. I believe that most if not all forms of various intra- and intercellular damage that we see the body accumulate with age do so because our cells gradually tone down the volume of various damage repair mechanisms. Our cells do so via epigenetic regulation of various genes upon receipt of endocrine signals that originate in the hypothalamus based on circadian rhythms and some sort of an internal clock. We know there is a clock because we can see how finely tuned the timings of various developmental and cyclical processes are - from embryogenesis to puberty to menstrual cycles.

So my belief is that the body has enough capacity for self-repair to function at the level of a 25-year-old for hundreds if not thousands of years, or maybe even longer. If the germ line can do so for billions of years, periodically generating a new organism from scratch, it seems logical to me that just a fraction of those remarkable bodybuilding abilities should be enough to sustain our bodies for much, much longer periods than we see today. So if we find a way to trick our cells into thinking that we are 25, they will function (and get replenished) at the level of a 25 year old regardless of our chronological age. To do so, they would need to have gene expression profiles (epigenetic profiles) typical of 25-year-old humans. And we know from the work of Hannum and Horvath that the epigenetic profiles of 25-year-olds are quite different from profiles of 45- and 65-year-olds.

So when we induce OSKM factors in cells, what I think happens is epigenetic rewinding that is associated with upregulation of various repair mechanisms. It is an empirical fact that induced pluripotent stem cells experience significant rejuvenation that ameliorates virtually all the famous Hallmarks of Aging: telomeres elongate, laminar defects get fixed, mitochondrial function gets restored and so on. There is a great article about this by Vittorio Sebastiano and Tapash Jay Sarkar of Stanford with plenty of details.

That said, one doesn't have to believe in programmed aging to see the potential of epigenetic rejuvenation for life extension purposes. In fact, Aubrey de Grey, who is one of our advisors, despite being a staunch opponent of the programmed hypothesis, also believes epigenetic rollback holds therapeutic promise. In his view, the ability to rejuvenate the aged body by reactivating early-life pathways does not in any way conflict with the idea that aging is unprogrammed and results from the gaps in our anti-aging machinery rather than the presence of actively pro-aging machinery. I would be more than happy to be proven wrong on the underlying mechanisms of epigenetic rejuvenation as long as it provides us with a lifespan extension comparable to that seen in Belmonte's work.

Conversely, why won't this treatment produce an unacceptable level of cancer risk? That is always a concern in this sort of thing.

Absolutely, teratomas are probably the biggest concern of this approach. In fact, before Belmonte showed that there is a Goldilocks zone of OSKM induction that extends lifespan without producing teratomas, cancer risk of this approach was thought to be prohibitive for its translation. Apparently, it isn't. The trick is to roll the cells back ever so slightly to prevent them from de-differentiation, but to do so often enough to prevent (or at least slow down) the accumulation of age-related damage that results from the relentless downregulation of damage repair mechanisms with age.

How does this fit together into your view of aging? What do you expect from this and other efforts in the years ahead? Where would you expect the biggest wins to emerge?

This fits my view of aging like a glove. In fact, the reason I got so excited about Belmonte's results back in February was because before I learned about them, I hypothesized that if we ever learn to roll back epigenetic changes, doing so periodically can provide us with a good enough "hack" to significantly delay aging until we completely decipher its mechanisms and learn to stop them for good. So epigenetic rejuvenation is precisely where I think the biggest gains in life extension could emerge. One other important area that we also plan to explore at Youthereum, albeit in a separate research track, is trying to decode hypothalamic exosome secretions. We think that Dongsheng Cai's latest paper, which showed that 16-months old mice exhibit signs of rejuvenation after a one-time injection with hypothalamic exosomes isolated from cultured hypothalamic neuronal stem cells, is really onto something.

Tell us about your take on how to merge the flow of funds in the blockchain market with the goal of doing something useful in longevity science. So much of what is going on in the ICO space seems a very clumsy effort to bolt one thing, the blockchain, onto another completely unrelated thing that has no logical connection to the blockchain. How are you different?

We are not trying to pretend that we will contribute something to the blockchain infrastructure. We won't, we are a decentralized biotech crowdfunding project that is raising money first and foremost for scientific research. In other words, we are users of the blockchain technology, not its developers. We plan to use it to eliminate any middlemen between us and our funding contributors, and to ensure that all our backers' rights to the therapies we plan to develop are not affected by various governmental red tape - current or future. Those are the two main benefits of decentralization, in our opinion. So we view ICOs as just a more efficient crowdfunding mechanism, even if that makes some blockchain purists cringe. I am not sure why they would cringe, though - by embracing the blockchain paradigm and bringing real-world projects into their realm we are actually validating their technology and greatly expanding its potential user base.

How does Youthereum Genetics differ from Open Longevity, who are trying their own hand at an ICO?

While Mikhail Batin of Open Longevity and I agree that we need more people to do everything possible to develop radical life extension therapies ASAP, we differ on what kinds of interventions could actually produce such life extension. I believe that no therapy that exists today, including any clinically approved drugs, can prolong our lifespans by more than 10%, let alone 30%. So in my view, conducting clinical trials for the Fasting-Mimicking Diet (FMD) or use of statins to see if they have the potential to prolong lifespan is not very useful. Epigenetic rejuvenation, on the other hand, does, in my view, have the potential to prolong our lifespans by over 30% or even much, much greater. That is why I am betting so much of my time and money on it.

If this all goes swimmingly well, and you are buried in funds, with decent animal data on the use of pluripotency factors as a therapy, what next?

Let me try answering this by first describing our research plan. We intend to subdivide it into 3 parallel research tracks: (1) development of an optimal dosing regimen using OSKM factors (2) search for safer factors of epigenetic rollback that do not lead to complete de-differentiation (3) creation of the best means of gene delivery, preferably patentable. So our key hypothesis is as follows: in order to reliably rejuvenate the entire body, we need to periodically roll back the epigenetic clock of most cells in the body, if not all cells. Thanks to the work of Belmonte's group, we know that this is possible by delivering OSKM factors (or other transcription factors) into the cell. However, this is a tricky endeavor: roll back too little and you get no sizable effect roll back too much and you might get cancer, as cells would lose their identity and become pluripotent again. After all, their ability to turn cells back into pluripotent state was the main selection criterion for picking the 4 OSKM factors from the original 24 candidates. So, while OSKM factors are effective and represent a "bird in hand", they are far from ideal for our purposes.

We should strive to find better, safer epigenetic rollback factors we plan to start by revisiting the remaining 20 factors of Yamanaka's original 24, and also try to use the Oct4 factor alone, since there is evidence that it alone is able to roll back epigenetics and is generally the main "guardian of the epigenetic gates." However, narrowing down the factors is only half of the challenge. Delivering them safely and, ideally, cheaply is the other half. The epigenetic aging program is quite robust even in the face of weekly rollbacks, as demonstrated by Belmonte et al., therefore, obtaining meaningful rejuvenation in humans would most likely require monthly or even weekly induction of epigenetic rollback factors (whether OSKM or otherwise). The most cost-effective way of achieving this would be to integrate a special, normally silent polycistronic cassette containing the genes for the rollback factors into virtually each cell of a patient. Such a cassette would be activated by a unique and normally inert custom agent that would need to be developed separately, and would enable this approach to be patentable. Today such cassettes are activated by, for example, tetracycline or doxycycline. With this approach, the marginal cost of a weekly induction of rejuvenating factors would only be the cost of the induction agent (presumably, a small molecule or a peptide) - comparatively cheap.

In summary, we see the most optimal research plan as a step-by-step, iterative improvement of the already proven approach, the induction of OSKM factors with doxycycline such a cassette with OSKM factors can be delivered to the body using a lentiviral carrier available on the market today. This will proceed in parallel with the development of an ideal therapy: maximally safe and effective factors activated by a unique, inert, patentable agent. Patentability is crucial for being able to interest Big Pharma in in licensing this therapy upon reaching the IND stage. If the project successfully reaches the IND stage, we believe Big Pharma companies will then be sure to license this therapy to begin clinical studies, first for prevention of atherosclerosis, Alzheimer's disease, diabetes or other age-related indications that anti-aging drugs are using today for regulatory purposes, as aging itself is not yet classified as an indication by the WHO. In a nutshell, that is our plan - get the therapy to the IND stage and then let Big Pharma do what it does best: validate it clinically. We estimate that to get to the IND stage it would take 5-6 years if all goes well.

"creation of the best means of gene delivery, preferably patentable."

Stem cells have now (almost) been created using antibodies:

"the TSRI team discovered two antibodies that can be substituted for both Sox2 and c-Myc, and in a similar set of tests they found two antibodies that can replace a third transcription factor, Oct4. The scientists showed that instead of inserting these transcription factor genes they could simply supply the antibodies to the fibroblast cells in culture.

In this initial study, the scientists were unable to find antibodies that replace the function of the fourth OSKM transcription factor, Klf4. However, Baldwin expects that with more extensive screening she and her colleagues eventually will find antibody substitutes for Klf4 as well. "That one I think is going to take us a few more years to figure out," she said."

Also mini proteins may be much easier and cheaper to manufacture than antibodies:

""These mini-protein binders have the potential of becoming a new class of drugs that bridge the gap between small-molecule drugs and biologics. Like monoclonal antibodies, they can be designed to bind to targets with high selectivity, but they are more stable and easier to produce and to administer," said Dr. Baker who with colleagues published their study in Nature ("Massively Parallel De Novo Protein Design for Targeted Therapeutics").

The technique relies on the Rosetta computer platform, developed by Dr. Baker and colleagues at the University of Washington. They designed thousands of short proteins, about 40 amino acids in length, that the Rosetta program predicted would bind tightly to the molecular target. "


Watch the video: Induction of Pluripotency by Defined Factors (January 2022).